ID: 1128518586

View in Genome Browser
Species Human (GRCh38)
Location 15:68360535-68360557
Sequence GATTCCAGGGCACCCCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128518586_1128518591 10 Left 1128518586 15:68360535-68360557 CCCACATGGGGTGCCCTGGAATC 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1128518591 15:68360568-68360590 AAGCTTCAGAGCAATGCTGCTGG 0: 1
1: 0
2: 0
3: 16
4: 185
1128518586_1128518593 24 Left 1128518586 15:68360535-68360557 CCCACATGGGGTGCCCTGGAATC 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1128518593 15:68360582-68360604 TGCTGCTGGTCAGCCAGGTGAGG 0: 1
1: 0
2: 6
3: 43
4: 367
1128518586_1128518592 19 Left 1128518586 15:68360535-68360557 CCCACATGGGGTGCCCTGGAATC 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1128518592 15:68360577-68360599 AGCAATGCTGCTGGTCAGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 227
1128518586_1128518594 27 Left 1128518586 15:68360535-68360557 CCCACATGGGGTGCCCTGGAATC 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1128518594 15:68360585-68360607 TGCTGGTCAGCCAGGTGAGGAGG 0: 1
1: 0
2: 4
3: 42
4: 492

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128518586 Original CRISPR GATTCCAGGGCACCCCATGT GGG (reversed) Intronic
900767839 1:4517430-4517452 GATTTCAGGGAACCACAAGTGGG - Intergenic
900857960 1:5201137-5201159 GATTCCAGTGCTGCCCATGGGGG + Intergenic
902207718 1:14881643-14881665 TATTTCAGGGCACCACATGGTGG + Intronic
902229433 1:15018504-15018526 TCTTCCAGGGGACCCCATGACGG - Intronic
902561103 1:17277958-17277980 CGTTCCAGGGCACAGCATGTGGG + Intronic
902871094 1:19314017-19314039 GATTCCAGGGTACCGCTTCTGGG + Intronic
910053866 1:83008516-83008538 GATCAGAGTGCACCCCATGTAGG + Intergenic
915031967 1:152887140-152887162 GATGCCAGGGCTCCCCACGGAGG - Intergenic
915142042 1:153773862-153773884 GCCTCCAGGGCACACCACGTGGG - Exonic
919774517 1:201185415-201185437 GATTCCAGGGGACCGCAAGGTGG + Intergenic
920387177 1:205577296-205577318 TCTACCAGGCCACCCCATGTGGG + Intronic
1062960027 10:1565961-1565983 GATTGCAGAGCCCTCCATGTAGG + Intronic
1064180308 10:13109048-13109070 GACTCCCGGGGACCCCTTGTGGG + Intronic
1064946782 10:20799340-20799362 GATACCAGGTCTCACCATGTTGG + Intronic
1067516518 10:46951179-46951201 GAGTCCAGGTTTCCCCATGTTGG + Intronic
1067645733 10:48100614-48100636 GAGTCCAGGTTTCCCCATGTTGG - Intergenic
1070459264 10:76648523-76648545 CATTGCAGGCCACACCATGTTGG + Intergenic
1070735700 10:78862188-78862210 CATCACAGGGCACCCCATATGGG - Intergenic
1072620334 10:97075177-97075199 GGTACCAGGGCACCTCATCTGGG + Intronic
1072751974 10:97987513-97987535 GATTCCAGGGCAACCAAGGAAGG + Intronic
1076516440 10:131047566-131047588 GATGCCAGGCCAGCCCATGTGGG - Intergenic
1078215909 11:9311621-9311643 ACCTCCAGGGCACCCAATGTTGG + Intronic
1078533335 11:12153836-12153858 TTTTCCTGGGCACCCAATGTGGG + Intronic
1080639853 11:34152326-34152348 GGTGCCAGGGCCCACCATGTCGG - Exonic
1081566948 11:44266010-44266032 GATTCCTGGTAACCTCATGTGGG + Intronic
1081997257 11:47373774-47373796 GATGCCTGGGCACCCCATGTTGG - Intronic
1083660715 11:64250725-64250747 GATTTCAGGGCACCTGCTGTGGG + Intergenic
1084224403 11:67706629-67706651 GCTTCCAGGGGCCCCCTTGTAGG + Intergenic
1084262242 11:67986547-67986569 GCTTCCAGGGGCCCCCTTGTAGG + Intergenic
1089555089 11:119311764-119311786 GAGACCAGGTCACCCCAAGTGGG - Intronic
1096454523 12:51774084-51774106 GATGACAGGCCAGCCCATGTGGG + Intronic
1100820256 12:98423088-98423110 GAGTGCAGGGCACCCCCTGGTGG + Intergenic
1102245375 12:111352658-111352680 GATGCCTGGGCACCCCATCATGG + Intergenic
1103897099 12:124279976-124279998 GATCCCAGGGCAGCCAGTGTGGG + Intronic
1105231653 13:18501866-18501888 GAGTCCAGAGCACCGCTTGTGGG - Intergenic
1106676334 13:31962775-31962797 GAATCCAGGGCACACTAGGTGGG - Intergenic
1107015762 13:35706704-35706726 CATTCCAGGACACCCGATGGGGG + Intergenic
1114017710 14:18446496-18446518 GATTCCAGAGCACCGCTAGTGGG - Intergenic
1116070594 14:40039555-40039577 GATTCCAAGGCACCGCATAGTGG + Intergenic
1119950590 14:78740012-78740034 GATGCCAGGGCACCCAACCTAGG - Intronic
1121227900 14:92334937-92334959 AAGTCCAGGGTACCCTATGTTGG + Intronic
1121252458 14:92510206-92510228 GATGCCAGGCCAGCCCCTGTGGG + Intergenic
1121842497 14:97145852-97145874 CATTCCAGGGCAGCCCAACTGGG - Intergenic
1123164126 14:106309295-106309317 GTTTCCTGGCCACCCCATGGTGG + Intergenic
1124200111 15:27672125-27672147 GATTCCGGTGCACCCCGAGTGGG + Intergenic
1128349890 15:66881673-66881695 GAGCCCAGAGCACCCCATGTTGG + Intergenic
1128518586 15:68360535-68360557 GATTCCAGGGCACCCCATGTGGG - Intronic
1129356606 15:74996003-74996025 GTTTCCAGGGAACGCCAGGTGGG - Intronic
1129980129 15:79861381-79861403 GTTTCCAGGGCATCACATGGAGG + Intronic
1132532809 16:461796-461818 GATTCCATGGCCACCCAAGTGGG + Intronic
1135219252 16:20599313-20599335 GAGACAAGGGCACCCCATGCAGG + Intergenic
1135738837 16:24956124-24956146 GATTCCAGGGCATCCCCTAGTGG - Intronic
1138203194 16:55105275-55105297 GCTTCCTGAGCACCCCATGCTGG - Intergenic
1143720260 17:8804209-8804231 GATTCCAGGGTAGGGCATGTTGG - Intronic
1144785154 17:17827371-17827393 GATTCCAGAGCACACCCTCTCGG + Intronic
1147150731 17:38512027-38512049 CATTCCAGGGAAGCCCAGGTAGG + Exonic
1147922063 17:43923796-43923818 GATTCCAGAGCCCCCTATGGAGG - Intergenic
1151468221 17:74301490-74301512 GAGTCCAGGCCTCCCGATGTTGG - Intronic
1152383005 17:79951911-79951933 GATTCCAGGGCACTCAGCGTTGG - Intronic
1154521661 18:15236838-15236860 GAGTCCAGAGCACCGCTTGTGGG + Intergenic
1160451113 18:78966447-78966469 GATGCCAGGGCACCCCTTGGTGG - Intergenic
1162127262 19:8506299-8506321 GATTCCTGGGCGCCCCCTGCTGG + Intergenic
1163777768 19:19228010-19228032 GACTCCAGGGCTCCCCAGGGGGG - Exonic
928096377 2:28407527-28407549 GACTTCAGGTCACCCCATGAAGG - Intronic
928318987 2:30268470-30268492 TGTTCCGGGGCAGCCCATGTCGG - Intronic
929728119 2:44454524-44454546 GCTTCCAGGGCACCTCCTCTGGG + Intronic
938521026 2:132070572-132070594 GAGTCCAGAGCACCGCTTGTGGG + Intergenic
938705786 2:133924317-133924339 TAGCCCAGGGCAACCCATGTGGG + Intergenic
941655557 2:168140673-168140695 CATTCGTTGGCACCCCATGTTGG - Exonic
946372596 2:219290010-219290032 GAGCCCAGGGCATCCCATGGGGG - Exonic
947579993 2:231309298-231309320 GTTTCCAAGGCAACCGATGTTGG - Intronic
948183497 2:236001245-236001267 CATGCCAGGGCTCCCCATGAAGG - Intronic
948239255 2:236416053-236416075 GTTTCCAGGGAACCCGATCTGGG - Intronic
1170152997 20:13245074-13245096 TATTCCCTGCCACCCCATGTTGG + Intronic
1171203469 20:23260382-23260404 GGTTCCAGAGCAAACCATGTGGG - Intergenic
1173711735 20:45163333-45163355 GATTCCAGGGCCCTCCATAAAGG - Intergenic
1175249192 20:57598555-57598577 GATTCCAAGGCAGCCCATTCAGG - Intergenic
1175601898 20:60281179-60281201 GATTCCAGAGCCCCCCAAGCAGG + Intergenic
1176032313 20:63018469-63018491 GATACCAGCGCACCCCAAATCGG - Intergenic
1176184673 20:63771706-63771728 GATTCCACGGGACCACCTGTCGG + Intronic
1176775624 21:13130168-13130190 GAGTCCAGAGCACCGCTTGTGGG - Intergenic
1179711704 21:43267330-43267352 TGTTTCAGGGCACCCCTTGTAGG + Intergenic
1180203163 21:46239481-46239503 GATTCCAAGGCACCTGATCTAGG + Intronic
1180442215 22:15377365-15377387 GATTCCAGAGCACCGCTAGTGGG - Intergenic
1180523346 22:16230905-16230927 GATTCCAGAGCACCGCTTGTGGG - Intergenic
1180523618 22:16233443-16233465 GATTCCAGAGCACCGCTTGTGGG - Intergenic
1181851788 22:25754815-25754837 AATGCGAGGGAACCCCATGTGGG - Intronic
1182835338 22:33337282-33337304 GAATCCAGGGTCTCCCATGTGGG + Intronic
1183864563 22:40693956-40693978 GATTCCAGAGCATCCCATGGGGG - Intergenic
953970852 3:47345725-47345747 GCTTCCAGGCCACCCCAGGCAGG - Exonic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
956622315 3:71233730-71233752 GATTCCTGGGGACCCCAAGAAGG + Intronic
967959914 3:194912205-194912227 GACTGCAGGGCTCCTCATGTTGG + Intergenic
968545463 4:1195536-1195558 GCATCCCGGGCACCACATGTGGG + Intronic
969020731 4:4138372-4138394 GCTTCCAGGGGCCCCCTTGTAGG + Intergenic
969733125 4:8969043-8969065 GCTTCCAGGGGCCCCCTTGTAGG - Intergenic
980884079 4:138743209-138743231 GATTCCAGGGCACACACTTTTGG - Intergenic
982719995 4:158849383-158849405 GATGCCAGGGCACCATATTTTGG + Intronic
983661335 4:170133268-170133290 GATTACAGGGAGCCCCGTGTTGG + Intergenic
986232065 5:5874843-5874865 GAGTCCAGGGCCCGCCTTGTGGG - Intergenic
988536611 5:32074300-32074322 GCTTCCAGGGCTCCCCTTGGGGG - Exonic
989132214 5:38118654-38118676 CCTTCCAGGGCAACCCAGGTGGG - Intergenic
993637858 5:90367086-90367108 GTTTCCAGGGCAACCCGTGGAGG - Intergenic
994243517 5:97451485-97451507 TATTCCAGGGCAAACCATGATGG - Intergenic
1001939709 5:175731810-175731832 GATTCCAGGGCAGGCCATCCAGG + Intergenic
1006803552 6:36774619-36774641 GATTCCAGGGAAACCCAGATGGG - Intronic
1007201653 6:40114751-40114773 GCCTCCCGGGCACCCCATATTGG + Intergenic
1007463826 6:42037687-42037709 TATTCCAGGGAATGCCATGTCGG + Intronic
1007632242 6:43278974-43278996 GGTTCCAGGTGTCCCCATGTGGG + Intronic
1007723917 6:43902739-43902761 GATCCTAGGGCACCCAATCTGGG - Intergenic
1014712518 6:124823797-124823819 GATTCTTGGGCACACAATGTAGG - Exonic
1014885915 6:126781159-126781181 GATTCCAGGGCACCACCACTGGG - Intergenic
1015083133 6:129252631-129252653 AATTCCAGGGCACCCCTATTTGG + Intronic
1019493510 7:1325751-1325773 GGTACCAGGGCCCCCCATGCAGG + Intergenic
1020073964 7:5245488-5245510 GATTCCTGGGCACGCAGTGTTGG + Intergenic
1021264557 7:18504061-18504083 GTTTTCAGGGAACCCCATGTAGG + Intronic
1023758406 7:43441284-43441306 AATTGCAGGGCTCCACATGTAGG - Intronic
1028116217 7:87001051-87001073 GTTTCCAGGGAACCTCATTTTGG - Intronic
1029214972 7:98941360-98941382 GAGACCAGGTCACACCATGTTGG + Intronic
1032611105 7:133415310-133415332 GATTCCTGGTAACCCTATGTTGG + Intronic
1033683270 7:143617276-143617298 GATTCCAGAGCACACCAGCTGGG + Intergenic
1033701343 7:143840362-143840384 GATTCCAGAGCACACCAGCTGGG - Intergenic
1039834483 8:41245884-41245906 GACTCCAGGGAACACCGTGTGGG - Intergenic
1040122885 8:43701965-43701987 GATTACAGGGAGCCCCATGTTGG + Intergenic
1040491345 8:47925055-47925077 CATGCCAGGCCACCCCATGGGGG + Intronic
1043664513 8:82791515-82791537 GATACCATTGCACCCCATCTTGG + Intergenic
1044413449 8:91910102-91910124 GCCTCCAGGGTACCCAATGTTGG + Intergenic
1049843134 8:144786997-144787019 GAGTCCAGGGGACCCCGCGTGGG + Intronic
1056795671 9:89657128-89657150 CATTCCAAGGCACGCCTTGTGGG + Intergenic
1058941417 9:109816171-109816193 CACTCCAGGGCACCTTATGTAGG + Intronic
1186205101 X:7192187-7192209 GATTCCATCCCACCCCATGCTGG + Intergenic
1187500968 X:19838431-19838453 AACTGCAGGGCACCCCATGGTGG - Intronic
1189704574 X:43747284-43747306 GTTTCCAGGGAACCCAATCTAGG - Intergenic
1192028303 X:67479914-67479936 GATTACAAGGGACCTCATGTTGG + Intergenic
1199894289 X:152116738-152116760 CATACCTGGACACCCCATGTGGG - Intergenic