ID: 1128519132

View in Genome Browser
Species Human (GRCh38)
Location 15:68364166-68364188
Sequence CAGGATTAGATGAAGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 272}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128519132_1128519135 -9 Left 1128519132 15:68364166-68364188 CCAGCCTTCTTCATCTAATCCTG 0: 1
1: 0
2: 2
3: 19
4: 272
Right 1128519135 15:68364180-68364202 CTAATCCTGGATAGTTGAGACGG 0: 1
1: 0
2: 1
3: 9
4: 132
1128519132_1128519138 24 Left 1128519132 15:68364166-68364188 CCAGCCTTCTTCATCTAATCCTG 0: 1
1: 0
2: 2
3: 19
4: 272
Right 1128519138 15:68364213-68364235 TGTAGCCCTTCCCTCGGCTGTGG 0: 1
1: 0
2: 0
3: 12
4: 120
1128519132_1128519137 18 Left 1128519132 15:68364166-68364188 CCAGCCTTCTTCATCTAATCCTG 0: 1
1: 0
2: 2
3: 19
4: 272
Right 1128519137 15:68364207-68364229 TCACTCTGTAGCCCTTCCCTCGG 0: 1
1: 0
2: 1
3: 23
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128519132 Original CRISPR CAGGATTAGATGAAGAAGGC TGG (reversed) Intronic
900386635 1:2413676-2413698 CAGGATTGCAGGAGGAAGGCAGG + Intronic
900832187 1:4973261-4973283 AGGGATGAGAAGAAGAAGGCTGG - Intergenic
902680750 1:18042248-18042270 CAGGCTTAGATGAACAGGGTGGG - Intergenic
903163280 1:21504163-21504185 CAGTATTAGAGGAACAAGCCCGG + Intergenic
904590850 1:31614650-31614672 CAGGATTAGATCAACAAGGCTGG + Intergenic
907727212 1:57030612-57030634 CAGGAATTGATGGAAAAGGCTGG - Intronic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
909677363 1:78253089-78253111 TGGGACTAGATGAAGAAAGCTGG - Intergenic
910427342 1:87130677-87130699 CAGAACCAGATGAAGAAGTCAGG - Intronic
911509656 1:98795702-98795724 AAGGATTAAATTAAGAAGCCAGG - Intergenic
911546919 1:99228169-99228191 GAGAATGAGATGAAGAAAGCGGG + Intergenic
911965235 1:104360344-104360366 CAGGATGAGGGGAAGAAGACAGG + Intergenic
912502685 1:110132693-110132715 CAAGATTAAATGGTGAAGGCAGG - Intergenic
913302568 1:117387919-117387941 CAGGATTAGATTAAGTAGTGAGG - Intronic
916348989 1:163827276-163827298 CAGGAGGAAATGAAGAAGGAGGG - Intergenic
917009848 1:170458371-170458393 GAGGGTTAGATGAAGCAGGGTGG - Intergenic
917454446 1:175174050-175174072 CAGGACTGGGTGAAGCAGGCAGG - Intronic
920215815 1:204360817-204360839 CAGGATCAGAGGCAGAAGGAAGG + Intronic
920362223 1:205426871-205426893 CAGGATGGGAGAAAGAAGGCAGG + Intronic
920776056 1:208938347-208938369 GAGGATGAGATGAAGGAGGAGGG - Intergenic
921663103 1:217831250-217831272 CATGATTAAATGAAGAAGGTAGG - Intronic
922208170 1:223467084-223467106 AAGGATGAGCTGGAGAAGGCTGG - Intergenic
923788404 1:237090383-237090405 GAGGATTACATGAGGGAGGCAGG + Intronic
924099791 1:240591434-240591456 CAGCATTTGATGAAGGGGGCTGG + Intronic
1063373637 10:5538517-5538539 CAGGAGTAGAAGAAACAGGCCGG - Intergenic
1063469473 10:6272836-6272858 CAGGGTCAGATGGAGGAGGCAGG + Intergenic
1063698417 10:8360311-8360333 CAGGGATAAATGAAGATGGCAGG - Intergenic
1064018912 10:11793904-11793926 CAGGATGAGAAGAGGAAGGCAGG + Intergenic
1064236322 10:13579596-13579618 CAAGATTAGATTAAGAAAGGAGG - Intergenic
1065287346 10:24198921-24198943 CAGTATTACATGAACAAGCCAGG + Intronic
1066106943 10:32164848-32164870 CAAGATGGGATGAAGAAGGATGG - Intergenic
1066106980 10:32165033-32165055 CAAGATGGGATGAAGAAGGATGG - Intergenic
1066804519 10:39232258-39232280 CAGGATTACAGCCAGAAGGCAGG + Intergenic
1066807443 10:39274273-39274295 CAGGATTAAAACTAGAAGGCAGG - Intergenic
1067220334 10:44339573-44339595 CAGGAAGAGAGGAGGAAGGCAGG - Intergenic
1068343419 10:55738709-55738731 AAGGATTAGATGAAGCAGAGGGG + Intergenic
1070699497 10:78589977-78589999 CAGGATGACATGAAGAGGTCTGG - Intergenic
1070992331 10:80743310-80743332 CAGTATTAGTTGAAGAAAGTAGG + Intergenic
1071122843 10:82299415-82299437 CAGGATTTGATGTAGAAATCTGG + Intronic
1071412673 10:85412464-85412486 CAGCATTGGATGGAGAAAGCAGG - Intergenic
1071876877 10:89852031-89852053 CAGGACTGGATTAAAAAGGCAGG - Intergenic
1073774128 10:106767172-106767194 CAGGCTTTGCTGATGAAGGCTGG + Intronic
1074225660 10:111481657-111481679 CAGGTTCATATGAAGAAGGCAGG + Intergenic
1074752458 10:116599825-116599847 GAGGATTACATGGACAAGGCAGG + Intronic
1078700273 11:13673882-13673904 TAGGATAAGATGGGGAAGGCTGG - Intronic
1079330152 11:19526548-19526570 CAGGATTGGATGAAGAAGAAGGG + Intronic
1081910740 11:46698298-46698320 CAGGATTAGAAGGAGCAGCCGGG + Intronic
1085514082 11:77102385-77102407 CAGGAGCAGGTGGAGAAGGCAGG - Intronic
1088379073 11:109173336-109173358 CAGAATTAGGGGAAGAAGGTTGG + Intergenic
1089668480 11:120035337-120035359 CAGGATTATCTGCAGAAGGAAGG - Intergenic
1090465014 11:126925812-126925834 CAGGAGAGGATGGAGAAGGCCGG - Intronic
1090889740 11:130913256-130913278 CAGAATTAGAACAAAAAGGCAGG + Intronic
1092171252 12:6375258-6375280 CAGGATTAGAGAGAGGAGGCAGG - Intronic
1095708533 12:45263653-45263675 CAGGATTACATGAAGAATGGGGG + Intronic
1097119689 12:56721593-56721615 CAGGATTAGATAAAGGTGACAGG + Intronic
1097242094 12:57582555-57582577 CAGGATTAGAAGAAGAAAAAAGG - Intronic
1099173088 12:79388889-79388911 CAGGCTTAGACAAAGAGGGCTGG - Intronic
1099590766 12:84586249-84586271 CAGGATTAGAGCAAGTAGGAAGG - Intergenic
1100346639 12:93738197-93738219 CAGGGTTAGAGGAAAAAGGAAGG + Intronic
1102699909 12:114830035-114830057 CAGAATAGGATGAAGAAGGGTGG + Intergenic
1103117167 12:118345433-118345455 CAGGAATAGAAGAGGAAGGAAGG + Intronic
1103204265 12:119116090-119116112 CATGAATGGATGAAGCAGGCTGG - Intronic
1103410857 12:120710544-120710566 AAGGAGGAGAAGAAGAAGGCGGG + Exonic
1104522360 12:129487423-129487445 CAGGAGTGGATGAGGAAGACTGG + Intronic
1105468933 13:20674020-20674042 CAGGATGAAATGAAAAAGTCTGG - Intronic
1105802298 13:23917583-23917605 CAGCATTAGATCATCAAGGCAGG + Intergenic
1105848141 13:24310615-24310637 CAAGATATGTTGAAGAAGGCTGG + Intronic
1107772209 13:43800051-43800073 CAGCATTAGTTGAGAAAGGCAGG - Intergenic
1107888497 13:44894114-44894136 CAGGCTTCGAGGCAGAAGGCTGG - Intergenic
1108462950 13:50685448-50685470 CATGATTAGATGTAAAAGGCTGG - Intronic
1110630960 13:77707898-77707920 CAGGTTGAGATGAAGAGGGGTGG + Intronic
1111912460 13:94327934-94327956 CATGCTTGGATGAAGAAGGCAGG - Intronic
1114447512 14:22800636-22800658 CACAATTTGATAAAGAAGGCCGG + Intronic
1117158015 14:52959879-52959901 GACAATTAGATAAAGAAGGCTGG + Intergenic
1118899447 14:69974267-69974289 GAGGATCAGAGGAAGGAGGCAGG + Intronic
1119977845 14:79045231-79045253 CAGTAGGAGATGAAGAAGGAGGG - Intronic
1120917061 14:89719629-89719651 CAGCATTAGATCCAGAAGCCAGG + Intergenic
1121918473 14:97857869-97857891 CAGGAGGAGATGAAGCTGGCAGG + Intergenic
1122465883 14:101933261-101933283 CAGGACAAGATGCACAAGGCAGG + Intergenic
1122977837 14:105178255-105178277 CAGGAGCAGATGAGGAAGGGTGG + Intronic
1122993978 14:105252754-105252776 GCGGCTTAGAGGAAGAAGGCAGG - Intronic
1123202615 14:106680859-106680881 GGGGATGAGATGAAGAAGGCTGG - Intergenic
1123875868 15:24623038-24623060 CAGAATTAAATGAATCAGGCTGG - Intergenic
1125180097 15:36872667-36872689 CAGGTTTAAATAATGAAGGCAGG - Intergenic
1126459234 15:48897408-48897430 CAGGAGTTGATGAAGAAAGGTGG - Intronic
1127027138 15:54819419-54819441 TAGGATTTGATAAAGAAAGCTGG - Intergenic
1128519132 15:68364166-68364188 CAGGATTAGATGAAGAAGGCTGG - Intronic
1128927918 15:71675656-71675678 GAGGGTTAGATGAAGGAGGTGGG - Intronic
1129043735 15:72714129-72714151 CAGGATGAGGGGAAGAAGCCTGG + Intronic
1130060461 15:80566244-80566266 CAGAGTTAGAGGAAGAAGGCAGG - Intronic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1134813586 16:17187853-17187875 GAGGATTAGAGGAAGAATGTGGG - Intronic
1135719345 16:24801878-24801900 CAGGATTAGATGAAGAGAGTGGG + Intronic
1136600929 16:31287905-31287927 CAGGACCACATGAGGAAGGCTGG + Intronic
1138205375 16:55120533-55120555 AAGGAATAGATGAAGACAGCAGG + Intergenic
1139339462 16:66258605-66258627 CACCCTTAGAAGAAGAAGGCAGG + Intergenic
1141794038 16:86257527-86257549 CATGATTAACTGAGGAAGGCTGG - Intergenic
1142734195 17:1884501-1884523 CAGGCTTAGATCAAGATGGGAGG - Intronic
1143749216 17:9016144-9016166 AAGGATGAGATGTAGAAGGTGGG - Intergenic
1144826900 17:18110214-18110236 CAGGATGAGGTGAAACAGGCTGG - Intronic
1148453632 17:47798205-47798227 CAGGATTGGGTGGAGAAGGAAGG - Intergenic
1150115009 17:62539797-62539819 CTAGATGAGATTAAGAAGGCTGG - Intronic
1150226692 17:63528298-63528320 CAGGAGTGGGTGAAGCAGGCAGG + Intronic
1150881467 17:69033452-69033474 CAGAACTAGATGAAGAATGCTGG - Intronic
1151084905 17:71368984-71369006 CAGGATGACAAGAAGAAGACAGG + Intergenic
1151374625 17:73678272-73678294 CAGTATCAGAGGAAGAAGGGAGG + Intergenic
1151708017 17:75781885-75781907 CACGTTAAGATTAAGAAGGCTGG - Intronic
1151852876 17:76701371-76701393 CGGGATGAGATGAGGAATGCCGG + Intronic
1152841576 17:82572241-82572263 CAGGATTAGATGAGGAAGACAGG - Intronic
1153765433 18:8370055-8370077 CAGGAATAGATGAAAATGCCAGG + Intronic
1157112279 18:44832647-44832669 CAGGAAGAGATGAGGAAGGCTGG - Intronic
1159247278 18:65823822-65823844 CAGAAGTAGATGCAGGAGGCAGG + Intronic
1160251988 18:77210692-77210714 CAGGGTGTGAAGAAGAAGGCAGG - Intergenic
1164122091 19:22275159-22275181 CAGCATTAGATGATGAACCCTGG - Intergenic
1164537236 19:29094956-29094978 CAGGATGAGATGAACAGGGGTGG - Intergenic
1165833740 19:38742543-38742565 CAGGATTAGGTGAGGATGGAAGG + Intronic
1166731426 19:45061093-45061115 CAGGTTTGGATGAGGCAGGCTGG + Intronic
1167784327 19:51625144-51625166 AAGGATTAGATGAGGTAGTCTGG + Intronic
1167798791 19:51727137-51727159 CAGGAAGAGATGACCAAGGCTGG + Intergenic
1168289693 19:55351596-55351618 AAGGAGTAGAGAAAGAAGGCGGG + Intronic
1168712624 19:58510732-58510754 GAGGTATAGATGAAGAGGGCAGG + Exonic
925641030 2:5985957-5985979 CAGGATGAGCTGAAGAAGAGGGG - Intergenic
926109370 2:10172262-10172284 TCGGATGAGATGAAGGAGGCTGG + Intronic
928694557 2:33836214-33836236 CAGGAGTAGGGGAAGAGGGCAGG + Intergenic
929365285 2:41147130-41147152 GTGGAAAAGATGAAGAAGGCAGG + Intergenic
932064080 2:68534687-68534709 CAGGACTAAATGTGGAAGGCTGG - Intronic
932641768 2:73455210-73455232 CAGAATTAAATGAAGATGACAGG + Exonic
934085857 2:88508973-88508995 CAGAATTTGATGAGGGAGGCTGG - Intergenic
938094053 2:128450208-128450230 AAGGAATGGATGAAGAAGACTGG + Intergenic
938492301 2:131767965-131767987 AATGATTAGATCATGAAGGCAGG - Intergenic
938495268 2:131794385-131794407 AATGATTAGATCATGAAGGCAGG + Intergenic
938697665 2:133849159-133849181 CAGCTTTAAAGGAAGAAGGCTGG - Intergenic
939581178 2:143947851-143947873 CAGGAGGAGGTGAAGAAGGAAGG + Intronic
940166105 2:150774208-150774230 GAGGATTATTTGAACAAGGCAGG + Intergenic
940238287 2:151534484-151534506 GAAGATTACCTGAAGAAGGCTGG + Intronic
941915701 2:170812270-170812292 CAGGATTAGGGGAAGAAACCTGG + Intergenic
942342097 2:174959484-174959506 CAGAATTAGTTGCTGAAGGCAGG + Intronic
942796479 2:179826369-179826391 CAGGGATAGAGGTAGAAGGCTGG + Intronic
942880262 2:180852333-180852355 AAGGATGAGAGGATGAAGGCAGG + Intergenic
943699844 2:190977808-190977830 CAGGATAAGAGGAAAAGGGCAGG + Intronic
943896192 2:193363743-193363765 CAGGAGTAGATGAATAAACCAGG - Intergenic
944347292 2:198684600-198684622 GAGGGTGAGCTGAAGAAGGCTGG + Intergenic
945259419 2:207830315-207830337 CAAGATTAAATGAGGTAGGCCGG + Intronic
946259532 2:218475319-218475341 CAAGATTATGTAAAGAAGGCTGG + Intronic
946960992 2:224985747-224985769 CAAGATTTGTTGAAGAAGGATGG - Intronic
948458410 2:238117917-238117939 GAGGAATGGATGAAGAAGGGTGG + Intronic
1169957733 20:11124480-11124502 AAGGATGAGATGAGGAAAGCAGG + Intergenic
1172827462 20:37802343-37802365 CAGGATGGGATGAAGAGGGTAGG + Intronic
1174415387 20:50362985-50363007 CAGGGTATGATGAAGAATGCAGG + Intergenic
1174531165 20:51215462-51215484 GAGGGCTAGAAGAAGAAGGCAGG + Intergenic
1175048457 20:56129559-56129581 CAGGGTTAGGGGAAGAAAGCAGG + Intergenic
1175710049 20:61212437-61212459 CAGCAAGAGATGAAGAGGGCTGG - Intergenic
1176709584 21:10137766-10137788 AATGATTAGATCATGAAGGCAGG - Intergenic
1176720448 21:10388294-10388316 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1177848056 21:26314704-26314726 AAGGATGAGATGTAGAAAGCGGG + Intergenic
1178281955 21:31291435-31291457 CAGGATCAGATGCAGATGGGAGG - Intronic
1179291400 21:40021037-40021059 GAGGCTGAGATGAATAAGGCTGG + Intronic
1180301652 22:11041143-11041165 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1181850844 22:25748911-25748933 CAGGCTTGGGTGAAGTAGGCTGG + Intronic
1182473742 22:30564538-30564560 CAGGAATAGATGGAGTGGGCTGG - Intronic
1182677311 22:32049773-32049795 AAGACTTAGATGAAGGAGGCAGG - Intronic
1184254288 22:43278333-43278355 AAGGAGTGGCTGAAGAAGGCAGG + Intronic
1184525704 22:45021024-45021046 CAGGATTGGATGAGGTCGGCAGG + Intergenic
1184626703 22:45739121-45739143 TAGGATGTGATGAAGAAGGTGGG + Intronic
1184703016 22:46189999-46190021 CAGAAATAGATGAACACGGCTGG - Intronic
1184921800 22:47610443-47610465 CAGGAGCAGCTGAGGAAGGCAGG - Intergenic
949952944 3:9244064-9244086 CAGGATAAAATGAAGAAAGCAGG - Intronic
950565459 3:13767289-13767311 CGGGATTAGAGGAAGCAGGAGGG - Intergenic
950902225 3:16508255-16508277 CAGGGATTGATGGAGAAGGCTGG - Intronic
954751549 3:52817019-52817041 CAGTATGAGAGGGAGAAGGCTGG - Exonic
955147883 3:56338332-56338354 CTGGATTAGATGAGGCAGGCAGG - Intronic
955238012 3:57156898-57156920 GAGGCTTAGATGAAGAAGACAGG - Intronic
955316706 3:57945303-57945325 CAGGCTCAGATGATGATGGCAGG - Intergenic
956909391 3:73801876-73801898 GAGGATTACATGAAGTTGGCAGG + Intergenic
958851655 3:99333759-99333781 CAGGACAGGATGTAGAAGGCTGG + Intergenic
959542662 3:107558080-107558102 CTGGGTTAGAGGAAGAAGCCAGG + Intronic
959756267 3:109903431-109903453 CACTATTAGATGAAGAAAGGAGG + Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
961640967 3:128364647-128364669 CAGCAGTAGATGAATGAGGCTGG - Intronic
962127487 3:132636479-132636501 AAACAGTAGATGAAGAAGGCAGG + Intronic
963615057 3:147526454-147526476 CAGTATTAGATCATTAAGGCAGG - Intergenic
963925584 3:150947481-150947503 CAGTATTAGATCATGGAGGCAGG + Intronic
964363705 3:155926306-155926328 GAGGATCATATAAAGAAGGCCGG - Intronic
965570276 3:170165454-170165476 CAGAATTATATGATGAAGGCTGG + Intronic
965680595 3:171247478-171247500 CGGGAAAACATGAAGAAGGCAGG + Intronic
966218455 3:177527044-177527066 CTGGGGTAGAGGAAGAAGGCTGG - Intergenic
968737710 4:2305959-2305981 CAGGACACGAGGAAGAAGGCAGG + Intronic
969277780 4:6148622-6148644 CAGGAGCAGAGGAAGAAGGGAGG + Intronic
970710465 4:18856146-18856168 CAGTAGTAGATGAAGAAGTAAGG + Intergenic
971076404 4:23154027-23154049 CAGGACTATTTGAAGAGGGCAGG - Intergenic
971076709 4:23157921-23157943 GAAGATAAGATGATGAAGGCAGG + Intergenic
971178030 4:24300125-24300147 CTGGAGTAGATAACGAAGGCAGG - Intergenic
972587556 4:40451862-40451884 CAAGGGTAGATGAAGAAGGAAGG + Intronic
972765154 4:42146097-42146119 CAGGATTGGCTGGAGAAGGAGGG - Intronic
973248273 4:48034080-48034102 GAGCATTAGAGGAAGGAGGCTGG + Intronic
974524636 4:63033070-63033092 AAGGATTACAAGAAGAAGGTAGG + Intergenic
975101616 4:70520744-70520766 CAGGGTGAGATGGAGCAGGCTGG + Intronic
977332663 4:95657267-95657289 CAGTATTAGATCATCAAGGCAGG - Intergenic
977450850 4:97195130-97195152 ATGGATCAGATGAAGAAGACTGG + Intronic
978197925 4:105991972-105991994 CAGGAGGACATGAAGAAGGATGG - Intronic
978310929 4:107384179-107384201 CAGTATTAGTTGAAGAAAGTAGG + Intergenic
978563694 4:110060022-110060044 CAGGATCTCATGAAGAATGCTGG + Intronic
978684255 4:111420041-111420063 AAAAATTGGATGAAGAAGGCTGG - Intergenic
980201879 4:129665978-129666000 CAGAAATACATGAAGCAGGCTGG + Intergenic
981562620 4:146064079-146064101 CAGGATTAATCCAAGAAGGCAGG + Intergenic
984286977 4:177742833-177742855 CAATGTTAAATGAAGAAGGCAGG + Intronic
984489848 4:180419174-180419196 CAGGAGTAGATGATAAAAGCTGG - Intergenic
984718962 4:182952651-182952673 CAAGAATGGATGATGAAGGCTGG + Intergenic
985099215 4:186441698-186441720 CAGCATCAGCTGAAGAAGCCTGG + Intronic
985385461 4:189442111-189442133 CAGGATTGGAAGAACCAGGCTGG + Intergenic
985893451 5:2734411-2734433 CAGGGTTATATGAAAAAGTCTGG + Intergenic
986227395 5:5828469-5828491 AAGGCTCAGATGCAGAAGGCAGG - Intergenic
986784909 5:11105247-11105269 CAGGATTATCTGAAGGAGGTTGG - Intronic
986823869 5:11499324-11499346 CAGAATTAGATGGACAGGGCAGG - Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
988856738 5:35234405-35234427 CAGGATTAGATGAAGGAAGGAGG - Intergenic
989749459 5:44875878-44875900 CAGGATTTGGTGAAGAGGACTGG + Intergenic
989796344 5:45478825-45478847 AAGAATAAGCTGAAGAAGGCAGG + Intronic
990363963 5:55050308-55050330 CAGGATTACTAGAAGAAGGGAGG - Intergenic
990408358 5:55514820-55514842 AAAGATAAGATGAAGAAGGAAGG + Intronic
998219264 5:140263118-140263140 CTGGACTAGATGGAGGAGGCCGG - Intronic
999704558 5:154260378-154260400 GAGGATTAGGCCAAGAAGGCTGG + Intronic
1000543538 5:162570331-162570353 CAGGATAAAAGGAAGAAGCCAGG + Intergenic
1000614405 5:163411693-163411715 CAGGATCTGTTGAAGAAGACAGG - Intergenic
1001016773 5:168149073-168149095 AAGAATTAGATGAAGCTGGCCGG + Intronic
1001135564 5:169099811-169099833 CTGCATTAGGTCAAGAAGGCAGG + Intronic
1001614041 5:173027774-173027796 CAGAACTTGATGAAAAAGGCAGG - Intronic
1001884533 5:175277525-175277547 AAGGATTGGCAGAAGAAGGCAGG - Intergenic
1001903777 5:175453822-175453844 CATGCTTAGACGAAGAAGGAGGG + Intergenic
1002289330 5:178188878-178188900 CAGGACTTGATGAGGAAGGTGGG + Intergenic
1003143052 6:3487537-3487559 CAGGAGTAGATGGACAAGGTGGG - Intergenic
1003183590 6:3811901-3811923 CAGGTTTAGATGAGGCATGCAGG - Intergenic
1003373661 6:5553247-5553269 CAGGAGTAGATGAGGATGGATGG + Intronic
1004880196 6:19999913-19999935 CAGGAAGAGAAAAAGAAGGCAGG - Intergenic
1006258902 6:32852702-32852724 CAGGATTTTATTAGGAAGGCTGG + Intronic
1006916363 6:37596528-37596550 CAGGTTTAAAAGAAGAAGGTGGG + Intergenic
1006919379 6:37617387-37617409 CAGGATTTGGTGAGGAAGGAAGG - Intergenic
1009147155 6:59692598-59692620 TAGGTTTAGATGAAGAAATCCGG - Intergenic
1011218007 6:85025738-85025760 CAGGATGAGATGTGGAATGCAGG + Intergenic
1012258378 6:97060381-97060403 GAGGATGAGCTGAAGAAGGAGGG + Intronic
1014056889 6:117026059-117026081 CAGGATTTGAGGAAGACTGCAGG + Intergenic
1016274560 6:142333898-142333920 TAGGATTAGAGACAGAAGGCCGG - Intronic
1017251562 6:152285570-152285592 CTGGAGTGGCTGAAGAAGGCTGG - Intronic
1017611459 6:156190789-156190811 CAGCACAAGGTGAAGAAGGCCGG - Intergenic
1018437359 6:163774476-163774498 GAGGATTGGGTGGAGAAGGCCGG + Intergenic
1018517817 6:164606209-164606231 CTGGATTAGAAGATGAAGGAAGG + Intergenic
1022902492 7:34824902-34824924 CAGGGTGGGATGAAGAGGGCAGG - Intronic
1024266441 7:47610456-47610478 CAGAGTTAGATGAACAAGGAAGG - Intergenic
1025255165 7:57379777-57379799 CAGGGTATGATGAAGAACGCAGG - Intergenic
1026400955 7:70012235-70012257 CAGGATTGGCTGGAGGAGGCAGG + Intronic
1027338608 7:77181410-77181432 GAGGAGGAGATGAAGAAGGCAGG + Intronic
1028116003 7:86998476-86998498 CAGGACTAGATGCAGAAGTTAGG - Intronic
1028759876 7:94483924-94483946 AAGGATTAGAAGAAGCAAGCCGG - Intergenic
1031123059 7:117742965-117742987 CAGGAAGAGGTGAAGCAGGCTGG - Intronic
1032044726 7:128595450-128595472 CTAGATGAGATTAAGAAGGCTGG - Intergenic
1032560811 7:132891524-132891546 CAGGATTAGATCAAGGCAGCTGG + Intronic
1033145334 7:138866203-138866225 CATGAGTAGATCAAGAAGGTCGG + Intronic
1033675426 7:143536779-143536801 TAGGATTAGATGAAGTTGGAGGG - Intergenic
1033696411 7:143792659-143792681 TAGGATTAGATGAAGTTGGAGGG + Intergenic
1038507650 8:28099383-28099405 CAGGAAGACAAGAAGAAGGCTGG + Intronic
1038542070 8:28398256-28398278 CAGTATAAGAGGGAGAAGGCTGG - Intronic
1042902424 8:73742714-73742736 CAGGATTATAGGGAGACGGCTGG + Intronic
1043678808 8:82996317-82996339 CAGGAACATATGATGAAGGCTGG + Intergenic
1043704562 8:83331917-83331939 CAGGACCAGAAGGAGAAGGCAGG - Intergenic
1046347996 8:112961907-112961929 CAGGATTATATGAAAAATGTGGG + Intronic
1047039630 8:120978591-120978613 CAGGATGAGATCCAGAAGGAAGG + Intergenic
1047041241 8:120998642-120998664 CAGGATTAGAGGAAGATAGAAGG + Intergenic
1050332527 9:4559958-4559980 CTGGATTAGAGGTGGAAGGCAGG - Intronic
1050480596 9:6083442-6083464 CAGTATTAGTTGAAGAAAGTAGG + Intergenic
1051878355 9:21813835-21813857 AAGGATAAGATGGAGAAGCCAGG + Intronic
1052350501 9:27453925-27453947 CAGCATAGGAGGAAGAAGGCAGG - Intronic
1053591000 9:39514603-39514625 TTGGATGAGATCAAGAAGGCAGG + Intergenic
1053646555 9:40123298-40123320 AATGATTAGATCATGAAGGCAGG - Intergenic
1053759159 9:41340253-41340275 AATGATTAGATCATGAAGGCAGG + Intergenic
1053848848 9:42269975-42269997 TTGGATGAGATCAAGAAGGCAGG + Intergenic
1054327568 9:63721200-63721222 AATGATTAGATCATGAAGGCAGG - Intergenic
1054538015 9:66252675-66252697 AATGATTAGATCATGAAGGCAGG + Intergenic
1054575306 9:66850687-66850709 TTGGATGAGATCAAGAAGGCAGG - Intergenic
1056328878 9:85505323-85505345 CAGCATCTGATGTAGAAGGCAGG + Intergenic
1056417386 9:86390112-86390134 GAGGATTAGCTGAAGCAGGGTGG + Intergenic
1058650094 9:107167532-107167554 CCGGAATAGATGATGAAGGCAGG + Intergenic
1059191102 9:112327267-112327289 AAAAATTACATGAAGAAGGCCGG + Intronic
1060352989 9:122875921-122875943 AAGGCTTAGGTGAAGAAGGGTGG + Intronic
1202794343 9_KI270719v1_random:106733-106755 AATGATTAGATCATGAAGGCAGG - Intergenic
1187992639 X:24892064-24892086 CAGAGTTAGAAGAAGAAAGCCGG + Intronic
1188824538 X:34814879-34814901 AAGGACTAGATTCAGAAGGCTGG - Intergenic
1188977117 X:36689105-36689127 CAGGACTAGAAGATCAAGGCAGG - Intergenic
1192273107 X:69602367-69602389 TAGGATTAGAAGCAGATGGCAGG + Intergenic
1193831882 X:86298179-86298201 CATCATTAGATGGAGATGGCTGG + Intronic
1194981812 X:100449380-100449402 CAGGAAAATATGAAGAAGGAAGG - Intergenic
1196117599 X:112014394-112014416 CCAGTTTAGATGCAGAAGGCTGG - Intronic
1198337499 X:135680979-135681001 AAGCATTAGATGAATAAAGCAGG - Intergenic
1198675327 X:139124837-139124859 CAGGATTTGGGGAAGAAAGCAGG + Intronic