ID: 1128521852

View in Genome Browser
Species Human (GRCh38)
Location 15:68380588-68380610
Sequence TCTGGGGAGCCTTCCTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 6, 3: 50, 4: 356}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128521842_1128521852 19 Left 1128521842 15:68380546-68380568 CCAGGTGTGGCAGGGCACAGAGG 0: 1
1: 1
2: 9
3: 89
4: 658
Right 1128521852 15:68380588-68380610 TCTGGGGAGCCTTCCTGGAGGGG 0: 1
1: 0
2: 6
3: 50
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128521852 Original CRISPR TCTGGGGAGCCTTCCTGGAG GGG Intronic
900184397 1:1326100-1326122 CCTAGGGAGCCTTCCACGAGTGG - Intronic
900531392 1:3155170-3155192 TCCCGGGGCCCTTCCTGGAGAGG - Intronic
900703555 1:4062364-4062386 TCTGAGGTGCCTTCCTGGAGTGG + Intergenic
900831647 1:4969790-4969812 TCCAGGGAGACTTCCTAGAGGGG + Intergenic
901846144 1:11983786-11983808 TCAGAGGAGGCTTCATGGAGCGG + Intronic
903278347 1:22235977-22235999 CCTGGGAAGGCTTCCTGGAACGG + Intergenic
904256342 1:29257395-29257417 CCTGGGGAGCCCTCCTGGAGCGG + Intronic
904623967 1:31791770-31791792 TCAGGGGTGCCTACCTTGAGAGG + Intronic
904679795 1:32221447-32221469 TTGGGGAAGGCTTCCTGGAGGGG - Intronic
904745612 1:32708959-32708981 GGTGGGGACCCTGCCTGGAGTGG - Intergenic
905018949 1:34795283-34795305 TCTGCAGAGCCTTCCAGGAGGGG - Exonic
905096485 1:35476018-35476040 TCTGGGAAGATTTCTTGGAGAGG - Intronic
906391270 1:45418956-45418978 TCAGGGAAGCCTTCTAGGAGGGG - Intronic
906588473 1:47001534-47001556 TTTGGGGAGGCTTCCTAGAGGGG + Intergenic
906621191 1:47280998-47281020 GCTGGAGAGCCTTCCTTGAGAGG - Exonic
906786581 1:48621186-48621208 TATGGGGAGCCTTCTGGGACAGG + Intronic
907241667 1:53084416-53084438 TGTGGGGAGCCCTGCTGGAGGGG - Intronic
907372245 1:54011088-54011110 TCTGTGGAGCATTGATGGAGTGG + Intronic
907424716 1:54372426-54372448 GCTGGGAAGGCTTCCTGGAGGGG - Intronic
907427011 1:54386274-54386296 GCTGGGTGGCCTTCCTGCAGTGG + Intronic
907773117 1:57486006-57486028 TTAGGGAAGCCTTCCTGGAAGGG - Intronic
907846157 1:58208985-58209007 TCTAGGAAGCCTTCCTTGAATGG - Intronic
907854728 1:58291405-58291427 GTAGTGGAGCCTTCCTGGAGAGG - Intronic
908951572 1:69568235-69568257 TCTGTGGAGCCTTCTGGGGGCGG + Intergenic
909395540 1:75167535-75167557 TCAGGGCAGGCTTCCTGGAGGGG - Intergenic
913682229 1:121197175-121197197 GCAGGGAAGGCTTCCTGGAGGGG - Intronic
914034065 1:143984796-143984818 GCAGGGAAGGCTTCCTGGAGGGG - Intergenic
914155381 1:145083174-145083196 GCAGGGAAGGCTTCCTGGAGGGG + Intronic
915069550 1:153254889-153254911 TCCAGGGAAGCTTCCTGGAGAGG + Intergenic
915513604 1:156400519-156400541 TCTAGGGCCCCATCCTGGAGGGG + Intergenic
915593963 1:156885948-156885970 TCTGGGCAGCCCTCCGGGATTGG + Intergenic
917040512 1:170801225-170801247 TCAGAGAAGCCTTCCTGGAGGGG + Intergenic
917143536 1:171862931-171862953 GTTGGGAAGCCTTACTGGAGTGG + Intronic
917585882 1:176425986-176426008 TCTGGAGAACCTGCCTGGTGAGG + Intergenic
920274693 1:204795420-204795442 TCAGGGCAGCCTTCCTGAACCGG + Intergenic
920469542 1:206215686-206215708 GCAGGGAAGGCTTCCTGGAGGGG - Intronic
921185669 1:212667428-212667450 TCTAGGAAGGCTTCCTGGTGGGG + Intergenic
921567068 1:216734028-216734050 TTTGGGAAGCCTTCCTGAAGGGG + Intronic
921699762 1:218254813-218254835 ACTTGGTAGCCTTACTGGAGGGG - Intergenic
922099065 1:222467350-222467372 GCTGGTGAGTCTTCCTGGAAGGG - Intergenic
923041684 1:230324110-230324132 TCTGGGTGGGCTTCCCGGAGGGG - Intronic
923326145 1:232881988-232882010 TCTGGGAAGTCTGGCTGGAGTGG - Intergenic
1063451912 10:6155624-6155646 TCCAGGAAGTCTTCCTGGAGTGG - Intronic
1064262733 10:13799002-13799024 TGTGGGAAGACTTTCTGGAGCGG - Intronic
1064430506 10:15266466-15266488 TCTGGAAACCCTTCCTGGACAGG - Intronic
1066602731 10:37125468-37125490 GCTGGCGGGCCTCCCTGGAGCGG - Intergenic
1067107714 10:43376882-43376904 CCAGGGAAGTCTTCCTGGAGGGG - Intergenic
1067309186 10:45096202-45096224 GCTTGGGAGGCTTCCTGGAAGGG + Intergenic
1068226933 10:54117771-54117793 TCTGTGAAGCCCTCGTGGAGAGG + Intronic
1069196048 10:65552725-65552747 TCTTGGGAGAATTCCTGGAGTGG + Intergenic
1069863561 10:71486348-71486370 TCAGGGAAGGCTTCCTGGAGGGG + Intronic
1070706993 10:78646970-78646992 TCAAGGAAGACTTCCTGGAGGGG - Intergenic
1070766347 10:79058609-79058631 TCAGAGGAGGCTTCCCGGAGAGG - Intergenic
1072623711 10:97097664-97097686 TCAGGGAAGACTTCCTGGAGGGG - Intronic
1073181787 10:101587962-101587984 TGTGGGGAGCCCTCCGGGAATGG + Exonic
1074408619 10:113202693-113202715 CCTGGAAAGCCTTCCTGGAAAGG + Intergenic
1075310415 10:121409136-121409158 TCTGTGAAGCCTTCCTGGGATGG + Intergenic
1075746859 10:124734052-124734074 GCAGGGAAGGCTTCCTGGAGGGG - Intronic
1075779972 10:125011143-125011165 TCTGGGGAGCCCACTTGGTGTGG - Intronic
1075870350 10:125768341-125768363 AGTGGGGAGCCTCTCTGGAGTGG - Intronic
1076791450 10:132779031-132779053 TGTGAGGAGCCTGCCTGGTGGGG + Intronic
1077160187 11:1109178-1109200 GCCGGGGAGGCTTCCTGGTGAGG - Intergenic
1077506885 11:2933710-2933732 TCTGAGAGGGCTTCCTGGAGGGG - Intergenic
1077907217 11:6544029-6544051 CCAGGGGAACCTTCCAGGAGAGG - Intronic
1078351833 11:10601321-10601343 TCAGGGGAGGCTTCATGGAGAGG + Intronic
1078510609 11:11981629-11981651 TCTGGTTAGCCTTGCTGCAGGGG - Intronic
1078890492 11:15552431-15552453 ACTAGGGAGCCTTGTTGGAGTGG + Intergenic
1079304365 11:19309210-19309232 TCTGATGTGCCTTCCTGGATAGG - Intergenic
1080419534 11:32097702-32097724 TCAGGGAAGGCTTCCTGGTGTGG + Intronic
1081842908 11:46216252-46216274 TCTGGGAAGCCTGAGTGGAGAGG - Intergenic
1083196219 11:61090214-61090236 TCAGGGAAGGCTTCCTGGAGGGG - Intergenic
1083492986 11:63026868-63026890 TATGGGCAGAGTTCCTGGAGGGG - Intergenic
1083571100 11:63762819-63762841 GCTCGGGAGCCTTCCCGGGGTGG - Exonic
1083620963 11:64049197-64049219 TCTGGGGGTCCTTCCAAGAGTGG - Intronic
1083652652 11:64212112-64212134 TCTGGGAAGGCTTCCTGGAGGGG + Intronic
1083797323 11:65024693-65024715 GCCGGGGAGGCTTCCTGGATGGG + Intronic
1084590762 11:70088754-70088776 TCCTGGGAGTCTTCCTGGATGGG + Intronic
1085025898 11:73236450-73236472 TCAGGGAAGGGTTCCTGGAGTGG + Intergenic
1085259131 11:75194254-75194276 CCTTGGGAGCCTTCTTGGAGAGG + Intronic
1085484928 11:76854799-76854821 TCAGGGGAGCCTTCCCAGAAAGG + Intergenic
1086951070 11:92890703-92890725 TCTGGGAAGTCCTCCGGGAGAGG - Exonic
1089195552 11:116692314-116692336 TCAGTGAAGGCTTCCTGGAGAGG - Intergenic
1090357154 11:126147626-126147648 TCTGGGGAGCCCCTCTGCAGGGG - Intergenic
1090387876 11:126367038-126367060 TGTGGGGGGCCTGCCTGTAGGGG + Intronic
1091458772 12:628288-628310 TATGAGGAGTCTTCCTAGAGGGG + Intronic
1091653731 12:2328864-2328886 TCTGTGGAGGCTGCCTTGAGTGG - Intronic
1097281776 12:57849251-57849273 TCTGGGAGGGCTTCCAGGAGAGG - Intergenic
1097399496 12:59112061-59112083 TGAGGGGAGCCTTCATGGATGGG + Intergenic
1101049257 12:100844278-100844300 TCTGGGGAGCATTCTCTGAGGGG + Intronic
1102778154 12:115539116-115539138 TCAGGGAAGGCTTCCTGGGGAGG + Intergenic
1103275846 12:119711445-119711467 TATGAAAAGCCTTCCTGGAGGGG + Intronic
1103761622 12:123254334-123254356 TCTCGGCAGCCTTCCTGCAGTGG - Intronic
1104957289 12:132473048-132473070 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957361 12:132473290-132473312 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957385 12:132473372-132473394 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957410 12:132473453-132473475 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957422 12:132473494-132473516 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957457 12:132473615-132473637 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957482 12:132473697-132473719 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957494 12:132473738-132473760 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104970120 12:132527300-132527322 TCTGAGGAGCATTTCTGGTGGGG + Intronic
1105643010 13:22285666-22285688 TCTGGGAAGGCTTCCTGGTGAGG + Intergenic
1107394335 13:39999684-39999706 CCAGGGGAGTCTTGCTGGAGGGG + Intergenic
1107622046 13:42243634-42243656 TCAGGGGCACCTTCCTGGATAGG + Intronic
1108274208 13:48791396-48791418 TCTGTGCAGCCTCCATGGAGAGG - Intergenic
1108590968 13:51912602-51912624 GCTGGCGAGGCTTCCTGGAGTGG - Intergenic
1108704534 13:52973360-52973382 TCTGGGGACCCTTGCTGAATTGG + Intergenic
1109277899 13:60322596-60322618 TCTGGAGAGTCTCCCTGAAGAGG + Intergenic
1112298704 13:98211170-98211192 TCTGGGGACCCCTCCTTTAGAGG - Intronic
1113848030 13:113403559-113403581 TCTGGGGACCCCTCCTGGGCCGG + Intergenic
1113887145 13:113666991-113667013 TCTGGGGCCCCTGGCTGGAGAGG - Intergenic
1114007880 14:18333334-18333356 GCTGGCGAGGCTCCCTGGAGCGG - Intergenic
1114233394 14:20803359-20803381 TCTGGGAAGCCTTCCAGCTGGGG - Intergenic
1114492979 14:23114749-23114771 TCTGGGGAAAGTTCCTGGAGTGG + Intergenic
1115627225 14:35205851-35205873 TTAGGGAAGACTTCCTGGAGAGG - Intronic
1117404351 14:55387432-55387454 TCTGGGGAGTGTTTATGGAGGGG - Intronic
1118164774 14:63325413-63325435 TCAGGAGAGACTTCCTTGAGAGG + Intergenic
1118645646 14:67836275-67836297 TGTGGAGAGCCTACCTGGTGAGG - Intronic
1119426991 14:74542164-74542186 TGTGGGGAACCTTCCTGGTAAGG + Intronic
1119666491 14:76488778-76488800 TCTGGGGAGGCTTTGTGGAAGGG - Intronic
1119747578 14:77055168-77055190 TCAGGGTAGATTTCCTGGAGAGG + Intergenic
1121634499 14:95444752-95444774 TCAGGGAAGGCTTCCTGGAGGGG - Intronic
1122268205 14:100556560-100556582 TCAGGGAGCCCTTCCTGGAGGGG - Intronic
1122345281 14:101054770-101054792 TCTGGAAAGTCTTCCTGGAGTGG - Intergenic
1122921640 14:104882754-104882776 TATGGGCAGCCCTCCTGGTGGGG + Exonic
1123018627 14:105387247-105387269 GCAGGGGAGCCTGGCTGGAGAGG - Intronic
1123642280 15:22408556-22408578 TCTGGGGGGTCTTCATGGGGGGG - Intergenic
1124222305 15:27861387-27861409 TCTGGGGAGCAGCCCAGGAGAGG + Intronic
1127465186 15:59237377-59237399 GCTGGGTAGCCTTCCTGCATGGG + Intronic
1127854970 15:62946735-62946757 TCTGGGAAGGCTTCCTGAGGAGG + Intergenic
1128474855 15:67988630-67988652 TCTGGTGAGGCTGCCTGGCGAGG - Intergenic
1128521852 15:68380588-68380610 TCTGGGGAGCCTTCCTGGAGGGG + Intronic
1129301766 15:74629615-74629637 TCTGGGACGCCTTGCTGGACTGG - Intronic
1129312829 15:74724615-74724637 TGGAGGGAGGCTTCCTGGAGGGG + Intronic
1129319812 15:74768215-74768237 TCTGGGGATGGTTCCTGGAAGGG + Intergenic
1129329752 15:74820987-74821009 TTTGGGGTGGCTTCTTGGAGAGG - Intronic
1129616139 15:77099947-77099969 TCTGGGAAGCCTTCTGAGAGGGG - Intergenic
1129671529 15:77610500-77610522 TCTGGGAAGCCAGGCTGGAGAGG - Intergenic
1129717536 15:77860844-77860866 TCTGGGGGTCCTTCTTTGAGGGG - Intergenic
1130379248 15:83357561-83357583 TCAGGGAAGGCTTCCTGGAAGGG + Intergenic
1131073364 15:89479687-89479709 TCAGGGTAGACTTCCTGGAGTGG - Intronic
1131195914 15:90354715-90354737 GCTGGGTGGCATTCCTGGAGAGG - Exonic
1132285001 15:100656556-100656578 TCAGGAGAGCCTTCCCTGAGAGG + Intergenic
1132367036 15:101265146-101265168 TCTGGGGAGCATTGTTGGGGAGG + Intergenic
1132677883 16:1128191-1128213 TCCAGGAAGCCTTCCTGGACTGG - Intergenic
1132797401 16:1731983-1732005 TCGGGGGAGCCTGCCTAGAATGG + Intronic
1132849270 16:2017199-2017221 TCAGTGTGGCCTTCCTGGAGAGG + Intronic
1133267346 16:4593132-4593154 GCTGGGAAGGCTTCCTGGAGGGG + Intronic
1134173777 16:11989839-11989861 TCAGAGAAGCCTTCCTGCAGAGG - Intronic
1134611963 16:15616210-15616232 TCTGGGTAGTTTTCCAGGAGGGG + Intronic
1135194442 16:20383034-20383056 TCAGGGGAGACTTCCTAGATGGG + Intronic
1135348096 16:21706336-21706358 TCTGGTGAGCACACCTGGAGCGG + Intronic
1136458761 16:30397244-30397266 TCAAGGGAGTCTTCCTGGAGAGG + Intronic
1136515606 16:30766384-30766406 CCTGCGGAGCCTTCCTGAGGAGG + Exonic
1138195396 16:55048128-55048150 GCTGGGGACCCTTCCCCGAGGGG - Intergenic
1138250016 16:55494811-55494833 TCTGTGAAGCCTTCCTTGACTGG - Intronic
1138272208 16:55703360-55703382 TCTGGGGATCCCACCTGGAGTGG + Intronic
1138291329 16:55849640-55849662 TCGGTGGTGCCTTCCTGAAGGGG - Exonic
1139561973 16:67748873-67748895 ACTGGGGAAGCTACCTGGAGGGG - Intronic
1140477653 16:75247058-75247080 CAGGAGGAGCCTTCCTGGAGGGG - Intronic
1141531512 16:84649369-84649391 TCTGGGCAGGCTGCCTGGGGCGG + Intronic
1141590729 16:85067035-85067057 GCTGGTGAGGCTGCCTGGAGGGG - Exonic
1141753046 16:85972227-85972249 TCTGGGGAGCCTTCGGGGATTGG - Intergenic
1142970660 17:3609455-3609477 TGTGGGGTGGCTTCCAGGAGGGG - Exonic
1145230290 17:21168994-21169016 ACTGGGGAGCCTTGCTGGGCTGG + Intronic
1146254825 17:31385718-31385740 TCAGGGAAGGCTTCTTGGAGGGG + Intergenic
1146568298 17:33932055-33932077 TCTGGGGAACCTACCTGGCCTGG - Intronic
1146763841 17:35501148-35501170 TCTGTGGAGCATCCCTGCAGGGG + Intronic
1147400667 17:40178335-40178357 TCTGGAGCGGCTTGCTGGAGGGG + Intronic
1147743411 17:42681367-42681389 TATGGGCATCCTTCCAGGAGAGG - Intronic
1149298748 17:55285024-55285046 TCTGGGGAGCTTTGCTGTTGTGG - Intronic
1150273030 17:63878933-63878955 TCTGGGGTGCTTTCCTGATGGGG + Intronic
1150278689 17:63916232-63916254 TCTGGGGTGCTTTCCTGATGGGG + Intronic
1150279787 17:63922851-63922873 TCTGGGGTGCTTTCCTGATGGGG + Intergenic
1150809691 17:68346824-68346846 TCTGTGGAGCCCTCTTTGAGGGG + Intronic
1151481792 17:74373883-74373905 CCTGGAGAGCCTCCCTGGAGAGG - Intergenic
1151576390 17:74954424-74954446 TCTGGGTGGGCTTCCTGGAAGGG + Intronic
1151903267 17:77031728-77031750 TGTGAGGAGCCATCTTGGAGTGG + Intergenic
1152223138 17:79080243-79080265 TCTGTGAAGCCTTCCTGGCCGGG + Exonic
1152414058 17:80147498-80147520 TCTGGGGACCCCGCCCGGAGCGG - Intergenic
1152436428 17:80279010-80279032 CCTGGGCAGCCTTCCTCGACTGG - Intronic
1152789789 17:82272990-82273012 TCTGGGGAGCCGACCTGGGTAGG - Intronic
1153354928 18:4124065-4124087 TGTGGGGAGCCTTAGTGGACAGG - Intronic
1153895002 18:9550815-9550837 TCTGAGGAGCCTTCCTGGAAGGG + Intronic
1154103594 18:11499969-11499991 TCAGGAAAGCCTTTCTGGAGGGG - Intergenic
1154177129 18:12093062-12093084 ACTGGGGAGGGGTCCTGGAGGGG + Intergenic
1154475137 18:14748045-14748067 GCTGGCGGGCCTCCCTGGAGCGG - Intronic
1155343692 18:24838024-24838046 AGTGGTGAGCCTTCCTTGAGTGG - Intergenic
1156456502 18:37297685-37297707 TTTGGGGACCCTGCCTGGAAAGG - Intronic
1157447424 18:47755872-47755894 TCAGGGAGGGCTTCCTGGAGAGG - Intergenic
1157693006 18:49698975-49698997 TCAGAGAAGGCTTCCTGGAGAGG - Intergenic
1158282643 18:55844306-55844328 TCTGGGGTGACTTTCTGGAAAGG + Intergenic
1160362673 18:78297146-78297168 CCTGAGGAGCTCTCCTGGAGAGG - Intergenic
1160722245 19:602878-602900 GCTGGGTGGCCTTCCTGGGGTGG + Intronic
1160793532 19:933630-933652 TCTGAGGAGCCTCCTAGGAGGGG + Intronic
1161108353 19:2455558-2455580 TCTGGGGACCCTTCCGTGAGAGG - Intronic
1161768037 19:6217496-6217518 TCAGGGTGGCCTGCCTGGAGAGG + Intronic
1161787062 19:6333364-6333386 ACTGGGGAATCTTGCTGGAGTGG - Intronic
1162790371 19:13059650-13059672 TTTGGGGAACCCTACTGGAGTGG + Intronic
1163690460 19:18735753-18735775 ACTGGGGAGCCTTGCAGGGGAGG - Intronic
1164484534 19:28643472-28643494 TCTGGTGAGCCAGCCTGCAGAGG - Intergenic
1164501339 19:28823013-28823035 CCTGGGGAGTCTCCCTGGACTGG - Intergenic
1164673299 19:30085462-30085484 TCTGGGGCTCCTTCCTGGCCTGG + Intergenic
1164683172 19:30149526-30149548 TCAGGGAAGGCTTCCTGGAGGGG + Intergenic
1165402873 19:35613025-35613047 TCTGGGGAGCCTCCCAGGGTAGG - Intronic
1165494296 19:36142591-36142613 TTTGGGGAGCCGTCCTGGCCGGG + Intronic
1165831781 19:38734145-38734167 TCTGGGGCTACCTCCTGGAGTGG - Exonic
1165925937 19:39326398-39326420 TTTGGGGAGATTCCCTGGAGAGG - Intergenic
1166053500 19:40274968-40274990 TCTGGGGACAGCTCCTGGAGAGG - Intronic
1167037926 19:47005232-47005254 TCTGGGAAGCTGTGCTGGAGAGG - Intergenic
1167106994 19:47436209-47436231 TCAGGGAGGGCTTCCTGGAGGGG - Intronic
1167239437 19:48334330-48334352 TCTGGGGACCCGTACTGAAGAGG - Intronic
1167666181 19:50823785-50823807 ACTGGGGAACCTCCCTGGGGAGG + Intronic
1167684439 19:50947429-50947451 TCAGGGGAGCCTCCTTGGAGAGG - Intronic
1167686253 19:50958522-50958544 TCAAGAGTGCCTTCCTGGAGGGG + Intergenic
925114929 2:1370200-1370222 CCTGGGGAGTCTTCCTGGGGGGG + Intergenic
925291677 2:2752185-2752207 GCTGGGGAGGCTGCCTGGACAGG - Intergenic
926047122 2:9717899-9717921 TCTGGGGAGACTGTCTGGAATGG + Intergenic
926890826 2:17637548-17637570 TCAGGGGAGGCATCCTGGGGTGG - Intronic
926960807 2:18356571-18356593 TCAGGGAAGGCTTCCTGGAAGGG - Intronic
926968674 2:18444373-18444395 TCTGGGGGGCCTAACTGGACAGG - Intergenic
927100448 2:19783853-19783875 TCAGGGAAGGCTTCCTGCAGTGG - Intergenic
927246617 2:20961835-20961857 TCTGGGGTGAATTCCTGGTGAGG - Intergenic
927784003 2:25959812-25959834 TCTGGGGAACCTGGCAGGAGGGG + Intronic
928365319 2:30695972-30695994 GGTGGGGACCCTTCCTGGAGGGG + Intergenic
929566016 2:42985483-42985505 TCTGGGAAGCCTTCCAATAGGGG + Intergenic
931105734 2:59053283-59053305 TCTTTGGAGCCTTCCTGTGGAGG + Intergenic
932023557 2:68112414-68112436 TCTGTAGAGCCTCCCAGGAGAGG - Intergenic
932417837 2:71584384-71584406 TCCAGGAAGCCTTCCTGAAGGGG + Intronic
932573690 2:72951309-72951331 TCTGGGGATATCTCCTGGAGGGG - Intronic
932594212 2:73084082-73084104 TCTGGGGAGCTGGCCGGGAGAGG - Intronic
933837386 2:86256861-86256883 TCTGGGGAGGATGCCTGGAAAGG - Intronic
934516012 2:94987317-94987339 TCGTGGGAGCCTTCCTGCAATGG - Intergenic
934898689 2:98140292-98140314 GCTGGTGAGCATTCCTGGATGGG - Intronic
935056845 2:99575026-99575048 CCTAGGAAACCTTCCTGGAGAGG + Intronic
939699363 2:145371158-145371180 TCGGGGGAGGATTCCTAGAGGGG + Intergenic
943651500 2:190462683-190462705 TCTTGGGAGGCTTCTTGGAAGGG + Intronic
944160357 2:196652986-196653008 TGTGGGGAGCATTCCTGAGGTGG + Intronic
944499875 2:200348517-200348539 TGTGGGAAGTCTTCCTGCAGTGG + Intronic
945326406 2:208487516-208487538 TCTGGGAGGTTTTCCTGGAGTGG - Intronic
947188180 2:227472824-227472846 TCTGGGCAGCCTTCGTGGGTGGG + Intronic
948403614 2:237701881-237701903 TCTCGGGAGCCAGGCTGGAGAGG - Intronic
948718031 2:239878336-239878358 TGTGAGGAGACTTCCTGGGGTGG + Intergenic
1169135316 20:3193831-3193853 CCTGGGAAGGCTTCCTGGGGAGG + Intronic
1171088447 20:22261740-22261762 TCAAGGGAGCCTTCCTGAAATGG + Intergenic
1171410263 20:24942307-24942329 TCTGGGGGGCATTTCTGGATGGG - Intergenic
1172672222 20:36642405-36642427 CCTGGGGAGGCTCCCAGGAGAGG - Intronic
1172698320 20:36837170-36837192 CCTAGGGAGGCTTCCTGCAGGGG - Intronic
1174083723 20:47989768-47989790 AGAGGGGAGCCTTCCAGGAGGGG - Intergenic
1174215322 20:48911977-48911999 TCTGGGGAACCTAACTGTAGTGG - Intergenic
1175042005 20:56061618-56061640 TCAGGGAAGGCTTCCTAGAGGGG - Intergenic
1175334456 20:58186095-58186117 TCTGGGCAGCTTGCCTGGTGGGG - Intergenic
1175491363 20:59383053-59383075 TCTGGGAAGCCCTCTTTGAGGGG + Intergenic
1175816314 20:61884837-61884859 GCGGGGAAGGCTTCCTGGAGAGG + Intronic
1178423865 21:32463313-32463335 TGTGGGCAGCCTTCCAGAAGTGG - Intronic
1178582969 21:33851300-33851322 TAAGGGGAGGCTTCCTCGAGGGG - Intronic
1178819381 21:35961597-35961619 ACTTGGGAGCCTTCCTTGATGGG - Intronic
1179502346 21:41818105-41818127 TGTGGTGAGCCTGGCTGGAGGGG - Intronic
1179566151 21:42250418-42250440 TCTGGGCATCCTGCATGGAGGGG + Intronic
1180432386 22:15264144-15264166 GCTGGCGAGGCTCCCTGGAGCGG - Intergenic
1180971773 22:19819689-19819711 TCTGTGGACCCTTCCTGCTGGGG + Intronic
1181310498 22:21942095-21942117 TCAGGGGAGCATGCCTGGGGTGG + Intronic
1181483045 22:23213147-23213169 TCAGGAAAGCCTTCCCGGAGAGG + Intronic
1182440258 22:30359196-30359218 TCTGGGTTTCCTTCCTGGAATGG - Intronic
1182440719 22:30362384-30362406 CCTGGGGAGCTTTCCTGAAGAGG + Intronic
1183303082 22:37068037-37068059 TCAGGGGAGGCTTCCAGGGGAGG - Intronic
1183472254 22:38015992-38016014 TCGGGGGAGAGTTCCAGGAGGGG - Intronic
1183752866 22:39732046-39732068 GCTGGGCAGCCTTTGTGGAGAGG + Intergenic
1184250583 22:43258031-43258053 CCTGGGGAGGCTTTCTGGGGAGG - Intronic
1184280851 22:43436622-43436644 TCTGGGCTGCCTCCCAGGAGGGG + Intronic
1184654070 22:45932394-45932416 TCTGGGAAGGCTGCCTGGACAGG - Intronic
949177057 3:1076860-1076882 TCAGGGAAGCCTCCATGGAGTGG + Intergenic
949538878 3:5016834-5016856 CCTGGGAAGCCTTCCTGAAAGGG + Intergenic
949879219 3:8648720-8648742 TTTTGGGAGCCTTCCAAGAGGGG - Intronic
950040472 3:9916425-9916447 GCTGGGGAGCCTGCCTGGTGGGG + Intergenic
950279033 3:11690013-11690035 TCTGGGGAGGGATCCTTGAGGGG - Intronic
950535857 3:13577775-13577797 CCTGGGGAGCTGGCCTGGAGGGG - Intronic
950545530 3:13635957-13635979 TCAGGGAGGCCATCCTGGAGGGG + Intronic
950665637 3:14493323-14493345 TCTGTGGGGCCTCCTTGGAGAGG - Exonic
954791463 3:53136310-53136332 TCAGGGAAGCTTTCCTGGAGGGG + Intergenic
955146865 3:56328238-56328260 TCTTGGAAGCCTTCTTGGGGAGG - Intronic
955237231 3:57150172-57150194 CCTGAGGAGCATTCTTGGAGTGG - Intronic
955408891 3:58643137-58643159 TGTGGTGAGCCTCTCTGGAGGGG - Intronic
956112980 3:65889786-65889808 TCAGGTAAGGCTTCCTGGAGGGG + Intronic
956410210 3:68971228-68971250 TTAGGGTAGCCTGCCTGGAGTGG + Intergenic
960540264 3:118854328-118854350 TCAGGGGAGCCTTCTTTGGGGGG - Intergenic
960588794 3:119345676-119345698 GCTGGGAAGCCTTTATGGAGAGG + Intronic
960761442 3:121077228-121077250 TCTGGGGACCCATCCGGGAGTGG - Intronic
960968898 3:123125116-123125138 CCTGGGGAGGCTTCCAGAAGGGG - Intronic
962243566 3:133772014-133772036 TCTGGGAAGGCTTCCTGGAGGGG - Intronic
962814780 3:138988094-138988116 TCAGGGAAGGCTTCCTGGAAGGG + Intergenic
964704188 3:159601199-159601221 TCTGGGCAGCCTGCATGGTGTGG + Intronic
965928273 3:174009801-174009823 CATGGGAAGCCTTCCTTGAGAGG + Intronic
967045822 3:185736006-185736028 TCTGGTTAGCCTTACTGGAGTGG - Intronic
967090283 3:186129284-186129306 TCTTGTGTGCCTTCCTGGGGAGG - Intronic
968129938 3:196187162-196187184 TCCGTGGAGCCTGCCAGGAGAGG + Intergenic
968700736 4:2056911-2056933 TCTGGCGAGGCTGCCTGGTGTGG - Intergenic
969085389 4:4652472-4652494 TCTGGGGCCTTTTCCTGGAGGGG - Intergenic
969246283 4:5935196-5935218 CCAGGGCAGCCTTCCAGGAGTGG - Intronic
969424759 4:7117706-7117728 TCTAGGAAGGCTTCCTGGAGCGG - Intergenic
969452004 4:7279405-7279427 TCAGGAGAGCCTTCCTGAACCGG + Intronic
969501060 4:7553228-7553250 TCAGGGGAGAGTTCCTGAAGGGG + Intronic
969598706 4:8163185-8163207 GCAGGGGAGCCTTGATGGAGGGG + Intergenic
970761479 4:19494365-19494387 TCTGGGGACCTTGCCTGGATTGG + Intergenic
976318812 4:83687725-83687747 TATGTGGTGCCTTCCAGGAGAGG - Intergenic
976642750 4:87356177-87356199 TCAGTGGAGCATTTCTGGAGAGG + Intronic
977015711 4:91691358-91691380 TTTAGGGAGCATTACTGGAGAGG + Intergenic
980181539 4:129407341-129407363 TTTGGGGAGACTTTCTGGAGAGG + Intergenic
984702254 4:182825895-182825917 CCTGGGGCGCCTTCCAGCAGGGG - Intergenic
984944377 4:184959745-184959767 CCTGGGGATTCTTCCTGGTGGGG - Intergenic
985009648 4:185569253-185569275 TCTGGGGAGACTGCCTGAAGAGG + Intergenic
985484184 5:139715-139737 TCACGGGGGCGTTCCTGGAGTGG + Intergenic
985488154 5:163279-163301 TCTGGGGATGTTTCCTGGGGCGG - Exonic
986577549 5:9228288-9228310 TTTAGTGAGGCTTCCTGGAGGGG + Intronic
990852658 5:60224595-60224617 GCTGGAGAGCCTACCTGGGGAGG - Intronic
996019704 5:118577771-118577793 TCTGGAGAGCATTTCTGGGGAGG - Intergenic
997581412 5:135019629-135019651 CCTGGGGAACCTGTCTGGAGGGG + Intergenic
997635033 5:135398731-135398753 CCTGGCGACCCTTCCTGGGGCGG - Intronic
998377120 5:141698539-141698561 TCTGGGAAGGCTTCCTGGAAGGG - Intergenic
998583652 5:143404323-143404345 TCTGGGGAGGCTTCAGGGAAGGG + Intronic
998945128 5:147330766-147330788 GGTGGGCAGCCTTCTTGGAGGGG - Intronic
999093528 5:148958220-148958242 TCAGAGAAGCCTTCCTGAAGAGG - Intronic
1001115431 5:168935358-168935380 TCAGGGAAGGCTTCCTGGAGGGG - Intronic
1001279611 5:170377394-170377416 TCTAGGAAAACTTCCTGGAGTGG + Exonic
1001710429 5:173773919-173773941 TCAGGGAAGCCTTCCTGAACGGG + Intergenic
1002453167 5:179331172-179331194 CCTGGGGACCCTTCCTGGCTGGG - Intronic
1002964491 6:1949727-1949749 TCTGGGTAGCCTTTCTGGTTGGG - Intronic
1004348341 6:14868971-14868993 GCTGGGGAGACGCCCTGGAGAGG - Intergenic
1006290022 6:33127839-33127861 GCTGGGGCTCCTTCTTGGAGGGG - Intergenic
1006320410 6:33316384-33316406 GCTGGGGTGCCATCCGGGAGTGG - Exonic
1006454666 6:34124932-34124954 TCTGGGAAGACCTCCTAGAGAGG - Intronic
1008474075 6:51917561-51917583 TCTGGGAAGCATTCCTGGAAAGG - Intronic
1012444968 6:99297827-99297849 TGTGGGAAGCCTTCATGCAGTGG - Intronic
1012682150 6:102195920-102195942 TCTGGGGAGCCCACCTGGCATGG + Intergenic
1017840928 6:158222372-158222394 TGTGGCCAGGCTTCCTGGAGTGG + Intergenic
1018042793 6:159939991-159940013 TGTGGGGAGGATTCATGGAGTGG + Intergenic
1018261656 6:161976382-161976404 TGTGTGGAGTCTTGCTGGAGTGG + Intronic
1018797801 6:167200827-167200849 TCTGGGAAACCCTCCAGGAGGGG + Intergenic
1018923532 6:168191701-168191723 CCTGGGGAGGCTTCTTGGGGAGG + Intergenic
1019421454 7:953113-953135 CCTGGGGAGCGTTCCTGAACAGG + Intronic
1019524030 7:1472754-1472776 CCAGGGGAGGCTTCCTGGGGAGG + Intronic
1020112452 7:5455228-5455250 TCTGGGGAGCACTCTTGGGGGGG + Intronic
1021572946 7:22083535-22083557 TCAAGGGAGCCTTCTTGGAAAGG + Intergenic
1022795223 7:33726752-33726774 TCTGGGCCGCCTCCCTAGAGTGG - Intronic
1023830817 7:44038161-44038183 ACAGGGGAGGCTTCCTGGAACGG - Intergenic
1024111489 7:46151630-46151652 GCTGGGGAGCCATCCTACAGTGG + Intergenic
1025106566 7:56175545-56175567 TCCGAGAAGCCTTCCTGGGGCGG + Intergenic
1026464660 7:70643831-70643853 TCTGGGGAGACTTGCTGATGTGG - Intronic
1027248015 7:76380184-76380206 GCTGGGGAGACTACCGGGAGAGG - Intergenic
1030822809 7:114116242-114116264 TTTGGAGAGCCTTCCAGGATTGG + Intronic
1032846196 7:135753955-135753977 TCGGGGAAGGCTTCTTGGAGGGG + Intergenic
1032911838 7:136441281-136441303 TCTGGGGAGATATCCTGTAGTGG + Intergenic
1033822628 7:145152484-145152506 TCTGGGAAGCATCCCTCGAGTGG + Intergenic
1034995047 7:155571745-155571767 CCCGCGGAGCCTTCCTGCAGGGG - Intergenic
1035291410 7:157841592-157841614 GCTGGGGTGCCTGCCTGGAAGGG + Intronic
1035373277 7:158392451-158392473 TCTGGGGAACCATCCTGGCATGG + Intronic
1037905508 8:22713907-22713929 TCAGGGGAGCCTGCAGGGAGAGG - Intronic
1037958175 8:23074869-23074891 TCTGCAGAGCCTTGCAGGAGAGG + Intergenic
1039247099 8:35620980-35621002 TCTGGGGAGCTTTCCTGTTCAGG + Intronic
1042742372 8:72064880-72064902 TCTGGTGAGGCTTCCTGGCGTGG - Intronic
1042758071 8:72240094-72240116 TCTGGCGAGGCTTCCTGACGTGG - Intergenic
1042814813 8:72866881-72866903 TCTGGGATACCTCCCTGGAGAGG - Intronic
1042894401 8:73651135-73651157 CCTGGGGAGCCTCCCTGGCCCGG + Intronic
1043859755 8:85302602-85302624 TCTTGAGAGCCATCCTTGAGGGG + Intergenic
1044609701 8:94079746-94079768 TCTTGGGAGCCTTCCTGCATAGG - Intergenic
1045037321 8:98185726-98185748 TCTGGGAAGCCTTCCAGTATCGG + Intergenic
1045825001 8:106386697-106386719 TGTGGGAAGCCTCCCTGGAAGGG + Intronic
1045905078 8:107335243-107335265 TCTTAGGTGCCTTCCTGGTGTGG + Intronic
1047213913 8:122862015-122862037 TCTGGGCCTCCTTCCTGAAGGGG - Intronic
1047294687 8:123560397-123560419 TCTGGGTTGCTATCCTGGAGAGG + Intergenic
1047327679 8:123855256-123855278 TTTGGGGAGCCTGACTGGAATGG + Intronic
1047556642 8:125939170-125939192 TGTGGGTGACCTTCCTGGAGGGG - Intergenic
1048846383 8:138606866-138606888 TCTGGGGAGCCATCATGCATGGG + Intronic
1049207100 8:141368642-141368664 TCTGGGAAGGCTTCCTGGAAGGG + Intergenic
1049216442 8:141410433-141410455 TCAGGGGAGCCTGCGTGGATGGG - Intronic
1049337431 8:142093878-142093900 CCTGGGAGGGCTTCCTGGAGTGG + Intergenic
1049477364 8:142802980-142803002 TCTGGGAAGGCTTCCTGGAGTGG + Intergenic
1049532032 8:143159696-143159718 TCTGGGGCGCAAGCCTGGAGGGG + Exonic
1049586087 8:143432966-143432988 TCTAGGGAGCCATCCTGGCTTGG - Intergenic
1049679368 8:143910801-143910823 CCTGGGGAGCCTGCCTGGGATGG + Intergenic
1049709335 8:144056617-144056639 TCGGGGCAGCCTTTGTGGAGCGG - Exonic
1049719236 8:144107977-144107999 TATGGGGAGCCCTCCTCCAGGGG - Intronic
1049790546 8:144470369-144470391 TCTGGACAGCCGTCCTGGACAGG + Intronic
1051697367 9:19783384-19783406 TCAGTGGAGTCTTCCTAGAGAGG - Intronic
1051707524 9:19896043-19896065 TCTGGGATGCCTTGCTGGACTGG + Intergenic
1052821482 9:33141021-33141043 TCTGGGAAGGCTTCCTGGGAGGG - Intronic
1054814814 9:69465065-69465087 TCTGGGTAGCATTCCTTGATAGG + Intronic
1056190588 9:84180630-84180652 TCTGTGAAGCCTTCCTTGATGGG - Intergenic
1057762946 9:97891129-97891151 TCTGGGCAGGCTTCCTGATGAGG + Intergenic
1057823461 9:98352748-98352770 TGGGGGTAGCCTTCCTGGTGTGG + Intronic
1057855088 9:98595480-98595502 TCAGGGAAGCCTTCCTGCAGGGG + Intronic
1059042092 9:110826173-110826195 ACAAGGAAGCCTTCCTGGAGGGG - Intergenic
1059298250 9:113291809-113291831 ATTGGGCTGCCTTCCTGGAGTGG - Exonic
1059443962 9:114326665-114326687 TCTGGGAAGGCTTCCTAGAAGGG + Intergenic
1059445169 9:114333442-114333464 TCTGGGAAGGCTTCCTAGAAGGG + Intergenic
1059791582 9:117646403-117646425 CCTGGGGACCCTCCCTGGTGTGG - Intergenic
1060250568 9:121983664-121983686 TCTGGGAAGCCTTCCCTGACAGG + Intronic
1060422818 9:123481665-123481687 TCAGGGAAGACTTCCTGGAGGGG + Intronic
1060995238 9:127872067-127872089 TCCGAGGAAGCTTCCTGGAGGGG - Intronic
1061091516 9:128429033-128429055 GCTGGTGAGCCTGCCTGGTGGGG + Exonic
1061257238 9:129460085-129460107 TCGGGGGAGCATCCCGGGAGGGG + Intergenic
1061377746 9:130236188-130236210 CCTGGGATCCCTTCCTGGAGAGG + Exonic
1061712270 9:132496748-132496770 TCTGGGAAGCCTTCCCGGATTGG - Intronic
1061832464 9:133304539-133304561 CCCGGGGCGCATTCCTGGAGGGG - Intergenic
1062023774 9:134331154-134331176 TCTGAGGAGGGTCCCTGGAGTGG - Intronic
1062376248 9:136263139-136263161 GCTGAGGAGGCTTCCTGGATGGG - Intergenic
1189251826 X:39606364-39606386 TCTAGGCAGCTTTCCTGGTGGGG - Intergenic
1190217927 X:48492565-48492587 TCGGGGCAGGCTTCCTAGAGGGG + Intergenic
1191918970 X:66233475-66233497 TGTGAGGAGCTTTCCTAGAGTGG + Intronic
1193083179 X:77425437-77425459 TCAGGGAGGCCTTTCTGGAGGGG + Intergenic
1196191848 X:112803005-112803027 GCTGAGCACCCTTCCTGGAGGGG + Intronic
1197136860 X:123071482-123071504 TCTAGGGAGCTTTCCTAGAGAGG - Intergenic
1200080780 X:153575395-153575417 TGAGGGGAGCCTTCCTGGTGTGG + Intronic