ID: 1128524487

View in Genome Browser
Species Human (GRCh38)
Location 15:68403110-68403132
Sequence TGGCAGGTCATGAACCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128524481_1128524487 -1 Left 1128524481 15:68403088-68403110 CCTGGGCTGTGTCAGGACCCATT 0: 1
1: 0
2: 2
3: 16
4: 165
Right 1128524487 15:68403110-68403132 TGGCAGGTCATGAACCTTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 164
1128524480_1128524487 0 Left 1128524480 15:68403087-68403109 CCCTGGGCTGTGTCAGGACCCAT 0: 1
1: 0
2: 3
3: 25
4: 252
Right 1128524487 15:68403110-68403132 TGGCAGGTCATGAACCTTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128524487 Original CRISPR TGGCAGGTCATGAACCTTGG AGG Intronic
900124240 1:1062498-1062520 GGGCAGGTCAGGAAGCTCGGGGG - Intergenic
901889532 1:12250739-12250761 AGCCAGGTCTTGAACCTGGGTGG + Intronic
903746400 1:25589751-25589773 TGGCAGGTCATGGAACTTCTTGG + Intergenic
904743919 1:32699393-32699415 TGGGAGGCCATGATCCCTGGTGG - Intronic
907267627 1:53272439-53272461 TGGCAGTGCATGAGCCTGGGGGG - Intronic
908132342 1:61085748-61085770 TGGCAGGTTCTTAACCTTTGGGG + Intronic
910211324 1:84796409-84796431 TGGAAGGCCATGAACTTTGCCGG - Intergenic
910675660 1:89814042-89814064 TGGCAGGAGATGAAACTTAGTGG - Intronic
911000896 1:93164353-93164375 GGACAGGTCATGAAGCTTTGGGG + Intronic
912906417 1:113712874-113712896 TGGCATGGCATGAACCTGGGAGG - Intronic
913342952 1:117778319-117778341 TGGCAGGCCATGAAAAATGGGGG - Intergenic
915054601 1:153114692-153114714 TAGCAGGTCATGAGACTAGGGGG - Intergenic
915801743 1:158801065-158801087 TGGGAGGTCATGAAAAGTGGTGG - Intergenic
916178491 1:162063188-162063210 TGGGAGATCTTGAACCTGGGAGG + Intergenic
916431333 1:164731883-164731905 TGGAAGGTCAGGAAGCTTCGTGG - Intronic
916833108 1:168513232-168513254 AGGCAGCACAAGAACCTTGGAGG - Intergenic
920035400 1:203061870-203061892 TGGCAGGTGAGGAGCCCTGGAGG + Intronic
922114815 1:222602770-222602792 TGGAATGGCATGAACCTGGGAGG - Intergenic
922604932 1:226884052-226884074 AGCCAGGCCATGAACCTGGGCGG - Intronic
923855306 1:237839221-237839243 TGGCAGATGATGAAGCTGGGAGG - Intergenic
1063994381 10:11604529-11604551 GGGCAAATCATCAACCTTGGAGG + Intronic
1068697115 10:59979747-59979769 TGGCAGCACCTGAACTTTGGCGG - Intergenic
1070920332 10:80180777-80180799 TTGCAGCACATGAACTTTGGGGG - Intronic
1071399130 10:85252369-85252391 TGAAAGGTCATGCACTTTGGAGG + Intergenic
1071546648 10:86534942-86534964 TGGAAGCTCAGGAAGCTTGGAGG + Intergenic
1071873855 10:89822731-89822753 TCTCAGGTCATGTCCCTTGGAGG - Intergenic
1072218389 10:93307383-93307405 TGGCATGGCGTGAACCTGGGAGG - Intronic
1074051217 10:109882792-109882814 GGGCAGGGAATGCACCTTGGAGG - Intronic
1076088251 10:127655110-127655132 GAGCATGTCATGAACCTTGTGGG - Intergenic
1076713244 10:132350600-132350622 TGGAAGGTCATGCAGCGTGGGGG + Intronic
1076904781 10:133356389-133356411 TGGCAGGTCAGGATCCTGGGCGG + Intronic
1077039099 11:510184-510206 TGGCATCTCATGAACACTGGGGG - Intergenic
1078615609 11:12862654-12862676 TTGCAGGTCATGAAATTTTGAGG + Intronic
1087679624 11:101204961-101204983 TGGAATGGCATGAACCTGGGAGG - Intergenic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1088881241 11:113975147-113975169 TGGCAGCTCCCCAACCTTGGTGG + Exonic
1089154246 11:116388401-116388423 TGGCAAATCTTCAACCTTGGAGG + Intergenic
1089619521 11:119714329-119714351 TGGCATGTCATGGCCCTGGGAGG - Intronic
1089873847 11:121701193-121701215 TGGCACCTCATGGACCCTGGTGG + Intergenic
1092033908 12:5313798-5313820 AGGCAGGGCTTGAACCTGGGAGG + Intergenic
1095710346 12:45281642-45281664 TGGGAGGTAATGGACCATGGGGG - Intronic
1101692376 12:107093853-107093875 TGGCCGCTCATGGCCCTTGGGGG - Intergenic
1101721113 12:107351481-107351503 TGCCAATACATGAACCTTGGGGG - Intronic
1102102916 12:110294557-110294579 AGGCAGGGCTTGAACCTAGGGGG + Intronic
1102421326 12:112805263-112805285 TGTCCAGTCATGAACCTTAGTGG + Intronic
1103732576 12:123037639-123037661 GGGCAGGTCATGTACGCTGGAGG - Intronic
1104664245 12:130636037-130636059 TGGCAAGAGATGAACCTTGAGGG - Intronic
1106118467 13:26837777-26837799 TGGGAGGTCATGAATCGTGGGGG - Intergenic
1106764100 13:32896464-32896486 TGGCTGGGCATGAATTTTGGGGG - Intergenic
1110635816 13:77766172-77766194 GGGCAAGTCATGAGCCTTGGTGG - Intergenic
1111633770 13:90877144-90877166 AAGCAGGACATGAATCTTGGAGG + Intergenic
1113289492 13:108889212-108889234 GGGCAGGCCATGCACCTTTGGGG + Intronic
1113630142 13:111876719-111876741 TGGGAGCTCAGGAACCTGGGTGG + Intergenic
1114999219 14:28401375-28401397 TGGCAGGTCATGAGACCTTGTGG - Intergenic
1116126936 14:40800357-40800379 TGTGAGGACATGAAACTTGGAGG - Intergenic
1119712366 14:76831389-76831411 TGGGAGCTCATGAAACCTGGAGG + Intronic
1122025792 14:98874855-98874877 TGGGAGGTTATGACCCTTTGGGG - Intergenic
1128249537 15:66154786-66154808 TTTCAGTTGATGAACCTTGGTGG + Intronic
1128524487 15:68403110-68403132 TGGCAGGTCATGAACCTTGGAGG + Intronic
1128877175 15:71211833-71211855 TGGCAGGTTATAAAGCTTCGAGG + Intronic
1133336455 16:5009684-5009706 TGGCTGGACATGAATTTTGGGGG + Intronic
1137613977 16:49836190-49836212 TGCCAGGCCTTGAACCTTGCTGG + Intronic
1141024659 16:80534280-80534302 TTCCTGGTCATAAACCTTGGAGG - Intergenic
1141551785 16:84811087-84811109 TGGCACCTCTTCAACCTTGGGGG - Intergenic
1143037060 17:4005391-4005413 GGGCAGGTCCTGGAACTTGGTGG - Exonic
1148337816 17:46852889-46852911 TTCCAGGTCATGACCCCTGGTGG + Intronic
1150398542 17:64839062-64839084 TGGCACAGCATGATCCTTGGTGG + Intergenic
1151405086 17:73881043-73881065 TGGATGGTCATGAACTTAGGGGG + Intergenic
1152476249 17:80520375-80520397 TGGCAGGTCAGGAATCTGGCTGG + Intergenic
1152512443 17:80799652-80799674 CTGCAGGTCATGAAGCTTGACGG - Intronic
1158145793 18:54310295-54310317 TGACAGCTCAGGAACCTTGAAGG - Intronic
1159138928 18:64369419-64369441 TGGCAGGTCATGAGACCTTGTGG - Intergenic
1159744577 18:72215106-72215128 TGGCAGGTCATGAGCATTTAAGG + Intergenic
1160195650 18:76753053-76753075 TTCCAGGTGATGAAACTTGGAGG + Intergenic
1160554993 18:79719061-79719083 TGGCAGCTCCCGAACCTGGGTGG + Intronic
1161117515 19:2506699-2506721 AGGCAGGCAATGAACCTGGGGGG - Intergenic
1162737537 19:12754870-12754892 TCGCGGGTCATAAACCCTGGAGG - Exonic
1162854880 19:13460602-13460624 GAGCAGGTCATGCACCTTGCTGG - Intronic
1165964085 19:39559856-39559878 AGGCAGGAGATGAACCTGGGAGG + Intergenic
1167016348 19:46843373-46843395 AGGCTGGTCTTGAACCATGGAGG - Intronic
934499712 2:94847636-94847658 TGGCTGGTCTTGAACTTTTGAGG - Intergenic
935804533 2:106732747-106732769 TGGCAGCTCCTGAGCCTGGGGGG + Intergenic
935883440 2:107590260-107590282 TGGAATGTCATGAACCTGGGAGG + Intergenic
936344292 2:111663332-111663354 GGGCAGGGCAGCAACCTTGGAGG + Intergenic
936926844 2:117745696-117745718 TGGGAGGTCATTAACCCTGCAGG + Intergenic
943936201 2:193919636-193919658 TGTTAGGTGATGGACCTTGGGGG + Intergenic
948244410 2:236466739-236466761 TGGGAGGTGATGGATCTTGGGGG - Intronic
948687218 2:239676893-239676915 TGGCAGGGCATGAACATGGGGGG - Intergenic
948846138 2:240683625-240683647 AGGCAGGTCAACAAGCTTGGGGG - Intergenic
948847719 2:240691103-240691125 AGGCAGGTCAACAAGCTTGGGGG + Intergenic
1169703849 20:8480390-8480412 TGTCAGGTCCTGAAACTGGGGGG + Intronic
1169730195 20:8777994-8778016 TGGGAGGTAATGAATCATGGGGG - Intronic
1173250440 20:41361602-41361624 AGGCAGGTCCTGAACCTGCGTGG - Exonic
1173304428 20:41834868-41834890 TAGCAGGTGATGGACCTTAGAGG + Intergenic
1174072049 20:47906156-47906178 TGGCAGGGCAGGAAGGTTGGGGG - Intergenic
1174151992 20:48492513-48492535 TGGCAGGGCAGGAAGATTGGGGG + Intergenic
1176200268 20:63857007-63857029 TGCCAGGGCAGGAACCCTGGGGG + Intergenic
1183679455 22:39319190-39319212 TGGGAGGTAAAGAAGCTTGGGGG - Intronic
1184982903 22:48106905-48106927 TGGCAGGTATTGGACCATGGGGG - Intergenic
949916207 3:8966593-8966615 TGACAGGGACTGAACCTTGGTGG + Intergenic
950193878 3:10995448-10995470 TGGCTGGTCCTCTACCTTGGTGG + Intronic
952291845 3:32024578-32024600 AGGCAGGACTTGAACCTGGGAGG - Intronic
952575781 3:34772995-34773017 GGGCATGTCATAGACCTTGGTGG + Intergenic
960854943 3:122093020-122093042 TAGCAGGTCATGGGCCCTGGGGG - Intronic
962976854 3:140453154-140453176 TGCGAGGCCAGGAACCTTGGTGG + Intronic
964923554 3:161927290-161927312 TGGGAGGTAATGAATCATGGGGG + Intergenic
968596772 4:1489890-1489912 TGGCAGGCCATGAGCCTGGCTGG + Intergenic
968756596 4:2419126-2419148 CGGCAGGTCATGAAAATCGGCGG - Intronic
969535938 4:7756145-7756167 TGGCGGGTCAGGACCCGTGGAGG + Intergenic
970285387 4:14507657-14507679 CAGCAGGTCCTGAACCTTGAGGG - Intergenic
973891660 4:55373641-55373663 TGGCAGGGCATGAGCCTTTGTGG + Intergenic
974516208 4:62915164-62915186 TTGCAGGTCTTGTACCTTAGTGG - Intergenic
975194374 4:71506567-71506589 TAGCAGCTCAAGAACCTTTGGGG + Intronic
977486825 4:97659526-97659548 TGTCAGCTCATGAACCTTGCTGG + Intronic
978084235 4:104631167-104631189 TGGAAAGTCATGAACCATGTGGG - Intergenic
980685710 4:136224990-136225012 TGGCAGGATATGAATTTTGGGGG + Intergenic
980702946 4:136456344-136456366 TGGGAGCTCATGAAACCTGGAGG - Intergenic
981538282 4:145823025-145823047 GGGCAGGTCATGACCCCAGGGGG - Intronic
990130333 5:52574468-52574490 TGACAGTTCCTGAGCCTTGGGGG - Intergenic
992436530 5:76760333-76760355 TGGCAGGCCAGGAAGCTGGGAGG + Intergenic
997513926 5:134472170-134472192 TGGTAGGTAATGAATCATGGGGG - Intergenic
1001574307 5:172751914-172751936 TGGTAGGGCAGGGACCTTGGCGG - Intergenic
1005423219 6:25674097-25674119 TGGGAGGTGATGAATCATGGGGG - Intronic
1006023657 6:31133200-31133222 TCCCAGGCCATGAACCTTGTGGG - Intronic
1007442132 6:41871277-41871299 GGGTAGGTCTTGAAACTTGGTGG - Intronic
1009699621 6:67159788-67159810 TGGGAGGTAATGAATCATGGGGG + Intergenic
1011817869 6:91213819-91213841 GGGGAGGGCATGAATCTTGGGGG - Intergenic
1012483175 6:99690293-99690315 TGGAAGGACATGAACCTGGTTGG + Intergenic
1015799050 6:137042647-137042669 CAGCATGTCATGAACCTTGTAGG - Intronic
1015914485 6:138202090-138202112 TGTCAGGACATGAAACCTGGGGG + Intronic
1016085837 6:139913205-139913227 AGGCAGGACATGAACCCGGGAGG + Intergenic
1017969249 6:159297122-159297144 TGTAAGGTCATGATCTTTGGAGG - Intergenic
1018529794 6:164750546-164750568 TGGCAGGTCATGCTCCTCTGAGG - Intergenic
1019294784 7:267946-267968 TGGGAGGACATGAATGTTGGGGG + Intergenic
1019745598 7:2698922-2698944 TGGCAGGTCTTGCAACTTGACGG + Intronic
1019928533 7:4208656-4208678 TGGCATGTCCAGATCCTTGGGGG + Intronic
1020754877 7:12189928-12189950 TTGCAAGCCATAAACCTTGGTGG + Intergenic
1022678504 7:32522696-32522718 TGGGAGGACATGAAATTTGGAGG + Intronic
1024518745 7:50284334-50284356 TGGCAGCTCTAGAACCTTGGAGG + Intergenic
1027641411 7:80737883-80737905 TATCAGGACATGAACCTTGTGGG - Intergenic
1034588782 7:152120912-152120934 TGGCATTTCATGAGCCGTGGCGG - Exonic
1034657114 7:152738710-152738732 AGGCAGGAGATGAACCTGGGAGG - Intergenic
1037674428 8:21041595-21041617 TGGGAGGTCAAGCACCTAGGGGG - Intergenic
1037992865 8:23332975-23332997 TGGCAGGTTTTCTACCTTGGTGG + Intronic
1038698942 8:29831524-29831546 TGGCATTTCATGAGGCTTGGAGG - Intergenic
1038746458 8:30259174-30259196 TGGGAGGTAATGAATCATGGGGG + Intergenic
1038765780 8:30426482-30426504 CGGCAGATCATGAACATTTGGGG + Intronic
1040855329 8:51943041-51943063 TGGGAGGTCATGAGACCTGGTGG - Intergenic
1041205508 8:55494889-55494911 GGGGAGGTCATGAAGCCTGGGGG - Intronic
1044540601 8:93404723-93404745 TGGCATTTCATCTACCTTGGAGG - Intergenic
1044652966 8:94517551-94517573 TGGAAAGTCATGAAAATTGGTGG - Intronic
1045561813 8:103271396-103271418 GTGCAAGTCATAAACCTTGGTGG + Intergenic
1047633540 8:126734444-126734466 AGGCAGGGCTTGAACCTGGGAGG - Intergenic
1048571492 8:135660681-135660703 TGTGAGGACATGAACTTTGGGGG - Intergenic
1048993871 8:139777045-139777067 TGGAAGGTGAAGGACCTTGGTGG - Intronic
1049623018 8:143607043-143607065 TGGCAGCACATGAGGCTTGGTGG + Exonic
1049820228 8:144628987-144629009 TGGCAGGTGCTGGACTTTGGTGG - Intergenic
1051780945 9:20688382-20688404 CGGCAAGTCATAAACCTAGGAGG - Intronic
1052389708 9:27865306-27865328 TGGCAGCAGATGAACCTTTGTGG + Intergenic
1053657446 9:40232899-40232921 TGGCTGGTCTTGAACTTTTGAGG + Intronic
1053907809 9:42862180-42862202 TGGCTGGTCTTGAACTTTTGAGG + Intergenic
1054369570 9:64379170-64379192 TGGCTGGTCTTGAACTTTTGAGG + Intronic
1054527149 9:66143329-66143351 TGGCTGGTCTTGAACTTTTGAGG - Intronic
1054677197 9:67868923-67868945 TGGCTGGTCTTGAACTTTTGAGG + Intronic
1058954389 9:109931945-109931967 TGGCAGGTCGGGAAGCTGGGAGG - Exonic
1061779325 9:132986525-132986547 TGGGTGGACATGAACTTTGGGGG + Intronic
1061877342 9:133551013-133551035 TGGCTGGTCAGGAGCCTGGGTGG - Intronic
1186179526 X:6959428-6959450 GCACAAGTCATGAACCTTGGTGG + Intergenic
1190794084 X:53725194-53725216 ATGCAAGCCATGAACCTTGGTGG + Intergenic
1192919799 X:75694647-75694669 CGGCAGGTACTTAACCTTGGGGG + Intergenic
1196215848 X:113050699-113050721 TAGTATGCCATGAACCTTGGGGG + Intergenic
1196625041 X:117868762-117868784 TGGCAGGTCATGACGCTTATGGG + Intergenic
1197496297 X:127186030-127186052 GAGCATGTCATGAACCTGGGAGG - Intergenic
1199326597 X:146505302-146505324 TGGTAGGTCATGAATGTTGGAGG - Intergenic
1201347442 Y:13000318-13000340 TGGCAGCTCTTGAAGCGTGGTGG - Intergenic