ID: 1128525965

View in Genome Browser
Species Human (GRCh38)
Location 15:68412471-68412493
Sequence CAGGCACCCAACATGGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128525958_1128525965 20 Left 1128525958 15:68412428-68412450 CCTGAATCACTCAGGGAATGACA 0: 1
1: 0
2: 2
3: 14
4: 197
Right 1128525965 15:68412471-68412493 CAGGCACCCAACATGGATTCTGG 0: 1
1: 0
2: 2
3: 7
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128525965 Original CRISPR CAGGCACCCAACATGGATTC TGG Intronic
901391152 1:8947139-8947161 CTGGCATTCAACATGGGTTCTGG + Intronic
902961743 1:19968475-19968497 CAGGCAACCCAGATAGATTCTGG - Intergenic
903971244 1:27120266-27120288 CAGGCACCCACCATGGCGCCTGG + Intronic
904465812 1:30707040-30707062 CAGGCACCCAGCATGGAGCTAGG + Intergenic
907602606 1:55785974-55785996 AATGCACCCAAGATGTATTCTGG - Intergenic
910959579 1:92747569-92747591 CAGGCACCCAACATCACTCCCGG - Intronic
911164539 1:94713071-94713093 CAGCCAGCCACCAAGGATTCTGG - Intergenic
911276091 1:95860994-95861016 CAGACACCAACCATGGATCCAGG - Intergenic
915464752 1:156090427-156090449 CTGGCACCAAACATGCACTCAGG - Intronic
917687895 1:177436469-177436491 CAGGCACTCAAAAAGTATTCTGG - Intergenic
920676676 1:208043017-208043039 CAGCCACCCAGCAGGGATGCAGG - Intronic
924668779 1:246102074-246102096 CAGGCACCTCATATGGTTTCTGG + Intronic
1063575611 10:7259456-7259478 CAGCCCCCCAACAAAGATTCTGG - Intronic
1068778444 10:60892869-60892891 CTGGCACCCAACAAGGATAACGG + Exonic
1070957319 10:80473065-80473087 CAGAAACCCAACATGGAAGCAGG - Intronic
1074394921 10:113089645-113089667 CAGTGACCCAACAAGAATTCAGG - Intronic
1074653637 10:115557406-115557428 CAAGCACCCAGCATGAATACTGG + Intronic
1074824816 10:117207010-117207032 AAGGCACCCATCCTGGATTTGGG - Intronic
1076399729 10:130173993-130174015 CAGGCACCCTGCAAGGATTTAGG + Intronic
1077326714 11:1967126-1967148 CAGGCACCCTGCCTGGCTTCAGG + Intronic
1079719970 11:23798255-23798277 CAGGCACCCAATCTGGCTTGGGG - Intergenic
1080047054 11:27820580-27820602 CAGGCACCCTGCATGGATATAGG + Intergenic
1082037417 11:47656632-47656654 CAGGCTGCCAAGATGGCTTCGGG - Intergenic
1084243539 11:67839407-67839429 CAGGCACACAAGATGGTTACAGG + Intergenic
1084695114 11:70748414-70748436 CAGGCACCCACCATGGTTGTGGG - Intronic
1085589943 11:77750939-77750961 CAGGCACCAAACATTGATTCTGG - Intronic
1087346823 11:96982149-96982171 CAGGCACCCCACCTGAATTAGGG + Intergenic
1090862721 11:130668829-130668851 CAGGCACCCCAAATTGCTTCAGG + Intergenic
1202809695 11_KI270721v1_random:22306-22328 CAGGCACCCTGCCTGGCTTCAGG + Intergenic
1094443518 12:30505434-30505456 CAGGCTCCCCACATCGCTTCAGG + Intergenic
1103780890 12:123398243-123398265 CAGCCACCCAAGATGGAGTGCGG - Intronic
1106933571 13:34693496-34693518 CATGCATGCAACATGGTTTCTGG - Intergenic
1107668341 13:42716236-42716258 CAGACACCAAAAATGGAGTCAGG + Intergenic
1108529675 13:51317123-51317145 CAGGCAGTCAGCATGGATTACGG - Intergenic
1108832894 13:54500611-54500633 CAATCAGCCAACATGGCTTCAGG - Intergenic
1109939681 13:69345076-69345098 CAGGCCCACCCCATGGATTCAGG - Intergenic
1112341036 13:98553175-98553197 CACGCACCCCACAGGGACTCTGG - Intronic
1112609152 13:100938842-100938864 CAGGCACCAAACATGGTGCCTGG - Intergenic
1116171160 14:41404818-41404840 CTGGCACCCAGTATGGATTGAGG - Intergenic
1116493098 14:45528790-45528812 CAGTCTCCCAAAATGGAATCAGG + Intergenic
1119144465 14:72298588-72298610 CAGGCACCCACCATGACATCCGG + Intronic
1119178177 14:72584977-72584999 CAGAAACCCAACATGCAGTCAGG + Intergenic
1122008172 14:98723169-98723191 CAAGCAGCAAACATGGCTTCTGG + Intergenic
1123919133 15:25058270-25058292 CACGCAGCCAACTTGGATGCAGG - Intergenic
1125089827 15:35777275-35777297 CAGGCAGCCACGATGGATGCTGG + Intergenic
1125711937 15:41794087-41794109 CAGGCACCCACCATCGTGTCTGG - Intronic
1128525965 15:68412471-68412493 CAGGCACCCAACATGGATTCTGG + Intronic
1128656979 15:69469741-69469763 CAGGCACCAAACATGGAGTCAGG - Intergenic
1130206619 15:81881461-81881483 CAGGCACACTACATGAAGTCAGG + Intergenic
1130294213 15:82632389-82632411 CTGTCACCCATCATGAATTCAGG + Intronic
1130724885 15:86428923-86428945 CAGGGACACACCATGGAATCAGG - Intronic
1130881756 15:88061552-88061574 CAGGCATGCCACATGGGTTCCGG - Intronic
1131883894 15:96888472-96888494 GAGGCACCAGACATGGATTCAGG - Intergenic
1133355273 16:5131744-5131766 CAGGCACACAAGATGGTTACAGG + Intergenic
1137455730 16:48616413-48616435 CAGGCCCACCACATGCATTCTGG - Intronic
1141616245 16:85211247-85211269 CTGGCACCCCACATGCTTTCTGG - Intergenic
1141631479 16:85290318-85290340 CAGGCCCCCAACCTGGAGTGCGG + Intergenic
1144886820 17:18468783-18468805 CAAGCTCCCATCATGGACTCTGG - Intergenic
1145145394 17:20475513-20475535 CACGCTCCCATCATGGACTCTGG + Intergenic
1145847844 17:28058556-28058578 CAGGCACCCATCATGGGACCAGG - Intronic
1146353557 17:32115880-32115902 CAGGCTGCCATCATGGACTCCGG - Intergenic
1148238807 17:45986502-45986524 CAGGCACCTCACAGGGAATCAGG + Intronic
1149556397 17:57576460-57576482 CACCCAGCCAACATGGATTATGG - Intronic
1149646419 17:58244781-58244803 CAGGCGCCCAACAAGGTTACTGG + Intronic
1150004493 17:61461727-61461749 CAGGCACACAAGAAGGATTCTGG - Intronic
1150584286 17:66503352-66503374 CAGACAACCAACATGTATACCGG + Intronic
1151202022 17:72475692-72475714 CAGGTACCCAGCCTGGATCCAGG + Intergenic
1151680294 17:75619509-75619531 CAGGCCCCCAGCCTGGATCCTGG + Intergenic
1152645628 17:81467339-81467361 CAGGCAGCCGACAGGGACTCTGG + Intergenic
1157256373 18:46143306-46143328 CAGGCACCCACCATGGCGCCCGG + Intergenic
1158733021 18:60046548-60046570 CAGGCACCCAATATCTATTTTGG - Intergenic
1159081081 18:63736926-63736948 TAGGTACCAAACATGGATTTGGG - Intergenic
1161379189 19:3955767-3955789 CTGCCACCCAACGTGGATTCTGG + Intergenic
1162541527 19:11299326-11299348 CAGGCACCCATGATCGATTGTGG + Intronic
1162884368 19:13685433-13685455 CAGGCACCCACCATCAATCCTGG + Intergenic
1163063189 19:14774814-14774836 CAGGCACCCACCATGGTGCCTGG + Intronic
1163173527 19:15549191-15549213 CAGGCACTCACCTTGGAGTCAGG - Exonic
1164625663 19:29726109-29726131 CAGACAACAAACATGGACTCAGG + Intergenic
1165439789 19:35818614-35818636 GAGGCACACAACCTGGATTGGGG + Intergenic
1167167412 19:47808255-47808277 CAGGCACCCACCATGATGTCTGG + Intronic
1167989545 19:53346536-53346558 CAGGCACCCACCATCGTGTCTGG - Intronic
925294072 2:2766284-2766306 CAGCCACCCAGCATGGAGTGGGG + Intergenic
925952274 2:8926486-8926508 CCTGCCCCCAACATGAATTCTGG - Intronic
927381644 2:22486362-22486384 CAAGCACCTAGCATTGATTCTGG + Intergenic
929263278 2:39890941-39890963 CAGTCACTCAATATGGATTTGGG + Intergenic
931419430 2:62112605-62112627 CAAGCACCCAACATTGTGTCAGG - Intronic
933180065 2:79216970-79216992 CAGGCACCAGTCATGGACTCAGG - Intronic
939174511 2:138734100-138734122 CAGGCACCCAACATGATGCCTGG - Intronic
940560903 2:155295464-155295486 CAGGGAGCCAACAGGAATTCCGG - Intergenic
943151151 2:184115227-184115249 CAAGCACCCAGCATAGCTTCTGG - Intergenic
943332883 2:186581228-186581250 CATGCAACCACCATGCATTCAGG + Intergenic
943960327 2:194255161-194255183 CAGGGAGCCAACATGCATGCTGG + Intergenic
945206693 2:207340469-207340491 CAGTTGCCCAATATGGATTCAGG + Intergenic
947840163 2:233202555-233202577 CAGGCACTCAACAGTGACTCTGG - Intronic
948247537 2:236499146-236499168 CATGCAGCCAACCTGGACTCAGG - Intronic
1169908809 20:10630391-10630413 CAGGCACCCACCGTGGGTTTGGG - Intronic
1170848027 20:19978666-19978688 CAGGCAATGAACATGTATTCAGG - Intronic
1172179974 20:32996905-32996927 CAGTCATCCAACATGGATAGTGG + Intronic
1173751415 20:45479800-45479822 CAGGTGCCCAAGATGGACTCAGG + Intronic
1181772169 22:25133683-25133705 CAGGCACCCACCATGGTGCCTGG + Intronic
1182472350 22:30556221-30556243 CAGGCACCCAGCCTGGACTCAGG - Intronic
950332032 3:12163626-12163648 TAGGCACCCAATAAGTATTCAGG + Intronic
961891627 3:130135150-130135172 CAGGCACGCAAGATGGGTACAGG + Intergenic
966051354 3:175620352-175620374 CTGGCGCCCAACGTGGATGCTGG - Intronic
967076077 3:186003311-186003333 CATGCATCCAATATGTATTCTGG + Intergenic
971152799 4:24051689-24051711 CAGGCACTGAACATGCATGCCGG - Intergenic
984411525 4:179404181-179404203 CCGGCACCCGTCATGGACTCGGG + Intergenic
984741970 4:183173686-183173708 CAGGCACCCAAGATGCAGTGTGG + Intronic
985498203 5:222993-223015 AAGGCACTCAACATTGAATCAGG - Intronic
986248688 5:6034682-6034704 CAGGTACTCAACTTGGAGTCAGG - Intergenic
990035849 5:51318730-51318752 CAGGCACCAAACACAGATGCAGG - Intergenic
990890516 5:60644191-60644213 CAGCCACCTAACATGGTTTTTGG - Intronic
996171109 5:120292900-120292922 CAAGCACCCAGCACTGATTCTGG + Intergenic
998055376 5:139071807-139071829 CAGGCACCCACCATCAAATCTGG + Intronic
998588758 5:143455172-143455194 CAGACACCTAATAGGGATTCAGG + Intergenic
1001241106 5:170070454-170070476 CAGACACACAACATGCATTCGGG - Intronic
1001402560 5:171454342-171454364 CAGGCAAAGAACCTGGATTCAGG + Intronic
1002023822 5:176383508-176383530 GAGGCCCCCAACCTGGCTTCTGG - Intronic
1005753445 6:28904391-28904413 CAGCCCCCCAGAATGGATTCTGG - Exonic
1006637713 6:35472414-35472436 CAGGCACACAACGTGGAGTCAGG + Intergenic
1007362800 6:41370853-41370875 CAGTCACACAACATGGTATCAGG - Intergenic
1009935806 6:70233102-70233124 CAGATACCCAGCAGGGATTCAGG - Intronic
1015435385 6:133180563-133180585 CAGGCACCCAACACCAAGTCCGG + Intergenic
1021474970 7:21050436-21050458 CCGGTACCCAACTCGGATTCTGG + Intergenic
1022486330 7:30781089-30781111 CAGGCACCTGACAAGGAGTCTGG - Intronic
1026878223 7:73891902-73891924 CAGGCACCCCACTTGGACTTGGG + Intergenic
1027771633 7:82414631-82414653 AAGGCACACCACATTGATTCAGG + Intronic
1029381213 7:100216025-100216047 CTGGCAGCCAACATGGATGTTGG - Intronic
1029400592 7:100342976-100342998 CTGGCAGCCAACATGGATGTTGG - Intronic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1032737433 7:134705125-134705147 CGAGCACCCAACATTGTTTCTGG + Intergenic
1032841007 7:135713718-135713740 CAGGCACCCACCATTGTGTCCGG + Intronic
1033077482 7:138263004-138263026 AAGGCACCCAATATGCAGTCTGG - Intergenic
1034210614 7:149359057-149359079 CAGGCTCCCAAGATGCATTGGGG + Intergenic
1040744980 8:50631423-50631445 CAAGCACACAAAATGGGTTCTGG - Intronic
1043082438 8:75783864-75783886 CAGGCACCCAGCATTGGTGCTGG + Intergenic
1044462078 8:92457426-92457448 CATGCACCCACCATGCATTTTGG + Intergenic
1047255508 8:123210638-123210660 CAGTCAGCCAACATGGACTGAGG + Intergenic
1047957290 8:129985450-129985472 CAGGCACCCAAGAGGAATTTGGG - Intronic
1052464364 9:28811347-28811369 AAGGGAACCAAAATGGATTCTGG - Intergenic
1055004498 9:71489954-71489976 TTGGCACCCTCCATGGATTCTGG + Intergenic
1060906644 9:127313087-127313109 CAGGGTCACAAGATGGATTCAGG + Intronic
1060925516 9:127452544-127452566 CATGCAAGCAACATTGATTCAGG - Intronic
1061720977 9:132551249-132551271 CTGGCACCCAAGAAGGAGTCAGG - Intronic
1061813970 9:133182165-133182187 CAGGCCCCCAGCATGGAGCCTGG - Intergenic
1061865878 9:133491570-133491592 CAGGCAACCCACATGCATTCTGG + Intergenic
1062674598 9:137733231-137733253 CAGGCACCCAGCATTGTTTTAGG + Intronic
1202106104 Y:21367808-21367830 CAGGCACCCAACATCACGTCCGG - Intergenic