ID: 1128527289

View in Genome Browser
Species Human (GRCh38)
Location 15:68421301-68421323
Sequence GTGTTTGAAGAACAGCCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128527286_1128527289 -9 Left 1128527286 15:68421287-68421309 CCAAGGTGCCTGATGTGTTTGAA 0: 1
1: 0
2: 1
3: 9
4: 154
Right 1128527289 15:68421301-68421323 GTGTTTGAAGAACAGCCCGGAGG 0: 1
1: 0
2: 3
3: 34
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128527289 Original CRISPR GTGTTTGAAGAACAGCCCGG AGG Intronic
901165253 1:7216263-7216285 GTGTTGGAGGAAGAGCCTGGGGG - Intronic
901259367 1:7860374-7860396 CTGTTTGAGGAACAGCCAGGAGG + Intergenic
901574513 1:10189996-10190018 ATGTTTCAAGAATAGCACGGAGG + Intergenic
902139567 1:14341526-14341548 GTGTTTGCAGAGCAGCCAAGAGG - Intergenic
903761747 1:25703311-25703333 GTGGCTGGAGAACAGCCCTGAGG + Intronic
904804774 1:33123042-33123064 GTGTTTGAAGAACAGAGGGGAGG - Intergenic
905142169 1:35856108-35856130 GTGGTGGAAGAAAAGCCGGGAGG + Exonic
905958990 1:42027558-42027580 CTGTGTGAAGAACAGCAAGGAGG - Intronic
907302886 1:53499453-53499475 CTGTTTGAAGAGCTCCCCGGGGG - Intergenic
908803920 1:67909962-67909984 GTGTTTGAGCCACAGCCCGTAGG - Intergenic
909613831 1:77583622-77583644 GTGTTAGGAGAGCAGCCCTGGGG - Intronic
909923163 1:81406565-81406587 TTATTTAAAGAACAGCCCAGAGG - Intronic
912198153 1:107424295-107424317 GTGTTTGAAGAGCAACATGGAGG + Intronic
916225963 1:162489878-162489900 GTGTTTGAAGAACAGGAAGCTGG + Intergenic
916250877 1:162736872-162736894 GTGTTTGAGGAACAACAAGGAGG + Intronic
918993718 1:191730195-191730217 GTGTTGGAGGAAAAGCCTGGTGG - Intergenic
920193797 1:204212880-204212902 GTGTTTGAAGAACAACAAGGAGG - Intronic
920698258 1:208198351-208198373 GTCTTTGAAGAAGAGCCCGGGGG + Intronic
922248536 1:223824832-223824854 GTGTTTGATGAACAGCAAAGAGG - Intronic
922277241 1:224090365-224090387 GTGTTTGAAAAACAGCATAGAGG - Intergenic
923261854 1:232275261-232275283 GTATCTCAAGAACAGCACGGGGG - Intergenic
923389744 1:233502319-233502341 GTGTTTGAAGAGTAGCCAAGAGG + Intergenic
924267770 1:242300510-242300532 GTGTTGGAAGAACATCAGGGAGG + Intronic
1063240251 10:4161902-4161924 GTGTTGGAAGAGAAGCCTGGTGG - Intergenic
1068693969 10:59946236-59946258 GTGTTTGAGAAAGAGCCAGGAGG + Intergenic
1068961186 10:62868248-62868270 GTGTTTGAAGCAAAGGCCAGAGG - Intronic
1069060372 10:63888554-63888576 ATGTTTGAGGAACAGCAAGGAGG + Intergenic
1072618292 10:97063907-97063929 GTGTTTGAAAATGAGCCAGGTGG - Intronic
1074896154 10:117779247-117779269 GTGTTTTGAGAAGAGCCTGGGGG + Intergenic
1075821986 10:125322500-125322522 GTGTTTGAGGAACAGCAAGAAGG + Intergenic
1076847701 10:133077489-133077511 GTGTGTGAAAAACTGCCCCGTGG + Intronic
1078250058 11:9609492-9609514 GTGTTTGAGGAACGGCAAGGAGG + Intergenic
1080392475 11:31861120-31861142 GTGTTTGAGGAACACGCCAGGGG - Intronic
1080924325 11:36740240-36740262 ATGTTTGAAGAACATCAAGGAGG + Intergenic
1081470827 11:43368908-43368930 TGGTTTGAAGAACATCCCGAGGG - Intronic
1083200933 11:61120692-61120714 GTGCTTGCAGGACAGCCAGGTGG - Intronic
1083557918 11:63646976-63646998 GTATTTGAAGAACAGGAAGGAGG - Intronic
1086848330 11:91779251-91779273 GTGTTTGATGAACATCCAGGGGG - Intergenic
1087495806 11:98889948-98889970 GTGTGGGAAGAAGAGCCTGGTGG - Intergenic
1088600719 11:111472276-111472298 GTGCTTGAAGAACAGTGAGGAGG - Intronic
1091427778 12:406411-406433 ACGTTTGAAGAACAGCCAAGAGG + Intronic
1091530482 12:1350239-1350261 GTGTTAAAAGAACAGGCCTGGGG + Intronic
1096811312 12:54172292-54172314 GTGTTGGAAGAACAGCAATGAGG - Intronic
1097710210 12:62909469-62909491 GTGTTTGAGGACCAGCAGGGAGG - Intronic
1098420572 12:70292560-70292582 GTGTTTGAGGAATAGCAAGGAGG + Intronic
1098663796 12:73134008-73134030 GTGTTTGAAGAACAACCCTCTGG + Intergenic
1100403197 12:94250130-94250152 ATGTTTGAAGAGCAGCAAGGAGG + Intronic
1100442221 12:94627578-94627600 GTGTTTGAGGCACAGCAAGGAGG - Intronic
1101139717 12:101782809-101782831 ATGTTTGAAGAAAAGCCAGGAGG - Intronic
1101317541 12:103643324-103643346 ATGTTTGAAGAACAGTGCGATGG - Intronic
1101504758 12:105336017-105336039 GGGTTTGAAGAATAGCGTGGAGG + Intronic
1102253135 12:111401050-111401072 GAGTTTGAGGAACAGCCAGGAGG + Intergenic
1102456547 12:113074446-113074468 GTATTTGAGGAACAGCAAGGAGG + Intronic
1102694132 12:114785057-114785079 ATGTTTGAAGAAGAGCAAGGAGG + Intergenic
1102940365 12:116936289-116936311 GTGTTTGAAGAACAGCAGGAAGG + Intronic
1103541167 12:121667606-121667628 GTGTTCAAGGAACAGCCAGGAGG - Intronic
1104168947 12:126261181-126261203 GTGTTGGAAGTAGAGCCTGGTGG + Intergenic
1105914454 13:24900262-24900284 GTGTTCAAAGAACAGCCAGGAGG + Intronic
1107708968 13:43133994-43134016 ATGTTTGAGGAACAGCCGGGCGG + Intergenic
1110636188 13:77769132-77769154 GTGTTTGAGGAAGAGCAAGGAGG + Intergenic
1112569478 13:100580698-100580720 GTGATGGAAGAACTGCCAGGGGG + Intronic
1115465906 14:33713904-33713926 GTGTTTGAGGAATAGCAAGGAGG - Intronic
1115676210 14:35677962-35677984 GTGTCTGAAGAACAGAGTGGTGG + Exonic
1116902677 14:50377051-50377073 GTGTTTCTAGAACAGCAAGGAGG + Intronic
1117294998 14:54370961-54370983 GTGTCTGAGGAACAGCAAGGAGG - Intergenic
1118020825 14:61712286-61712308 GTGTTTTAAGAACAGTAAGGAGG + Intronic
1118182861 14:63510647-63510669 GTGTTTGAGAAACAGCAAGGAGG + Intronic
1118991005 14:70796872-70796894 GTCTTTGAAAAGAAGCCCGGAGG - Intronic
1119519330 14:75274255-75274277 GTGTATAAAGAACACCCCAGTGG - Intergenic
1120725571 14:87936095-87936117 TTGTGTGAAGAGCAGCCTGGAGG - Intronic
1121384923 14:93511209-93511231 GTGTTGGAGGAGCAGCCCAGTGG - Intronic
1121822237 14:96980851-96980873 CTGTTAGTAGAACAGCCCAGTGG + Intergenic
1125066231 15:35488557-35488579 GTGTTACAAGAACAGCATGGGGG + Intronic
1126498107 15:49314953-49314975 GTGCTGGAAGCACAGCTCGGAGG + Intronic
1128527289 15:68421301-68421323 GTGTTTGAAGAACAGCCCGGAGG + Intronic
1130428593 15:83823684-83823706 CTGTGTGAAGAACAGACTGGAGG - Intronic
1132364251 15:101245091-101245113 GTTTTGGAAGATCAGCCCAGCGG - Intronic
1132738288 16:1397990-1398012 TTCTGTGAAGAACAGCCCCGGGG - Intronic
1133105893 16:3509275-3509297 GTGTTTGAGGAAAAGCAAGGAGG + Intronic
1133842009 16:9418458-9418480 GGGTATGAGGAACAGCCAGGTGG - Intergenic
1133874046 16:9716482-9716504 GTGTTTGAGGAACAGGCAGGAGG + Intergenic
1134041325 16:11070733-11070755 GTGTTTGAAGAAGAGCAAGGAGG - Intronic
1134749650 16:16615778-16615800 GTGTTTGAGGACCAGCGGGGAGG + Intergenic
1134995820 16:18737846-18737868 GTGTTTGAGGACCAGCGGGGAGG - Intergenic
1135645826 16:24160921-24160943 GTGTTTGAGGAACAGCGAGGAGG + Intronic
1136343001 16:29657060-29657082 CTGTGTGGAAAACAGCCCGGAGG + Intergenic
1136415328 16:30099600-30099622 CTGTTTGATTAACAGCCCAGAGG - Intergenic
1137731083 16:50691022-50691044 ATATTTGAGGAACAGCCAGGAGG + Intergenic
1137938560 16:52658593-52658615 GTGCCTGAAAAACAGCCCTGTGG + Intergenic
1138158083 16:54724849-54724871 GTGTCTGAAGAACAGTGGGGAGG - Intergenic
1138192913 16:55031216-55031238 GAGTTTGAAGGATAGCCTGGAGG - Intergenic
1138537289 16:57666826-57666848 GTGTGTGAAGAAGCGCCTGGGGG - Intergenic
1139198264 16:64946535-64946557 GTGTGTGAAGAGAAGCCAGGAGG + Exonic
1140141454 16:72261994-72262016 GAATTTGAAGAAAAGCCCTGTGG - Intergenic
1141643978 16:85357594-85357616 GTGTCTGCAGAGCAGCCGGGAGG + Exonic
1144798063 17:17905947-17905969 GTGTTTGAGGAATAGCAAGGTGG - Intronic
1147338606 17:39740939-39740961 GTGTTTGGAGAACAGGCTGGGGG + Intronic
1148761980 17:50009185-50009207 GAGTTTGAAGAACAGCAAGGAGG + Intergenic
1150611916 17:66740022-66740044 GTCTTTGAAAAACACCCTGGAGG + Intronic
1150660471 17:67071816-67071838 GTGTTTGCAAAACAGCCTAGGGG - Exonic
1156447013 18:37244631-37244653 CTGTTTCAAGAACAGCCATGAGG + Exonic
1156655617 18:39282522-39282544 GTGTTTGAAGTACAGGCTGAAGG + Intergenic
1160699553 19:499183-499205 GTGTTGGAGGAACAGCGAGGAGG - Intronic
1160988414 19:1850834-1850856 GTGTTGGAGGAACAGCGAGGAGG + Intergenic
1161243046 19:3233626-3233648 GTGTTGGAGGAACAGCAAGGAGG + Intronic
1161262489 19:3345556-3345578 GTGTTGGAGGAACAGCAAGGAGG - Intergenic
1161267906 19:3373471-3373493 GTGTTAGAGGAACAGCGAGGAGG - Intronic
1161274897 19:3410480-3410502 GTGTTGGAGGAACAGCGAGGAGG + Intronic
1161291836 19:3498123-3498145 GTGTTGGAGGAACAGCGAGGAGG - Intronic
1161301613 19:3545427-3545449 GTGTTGGAAGAACAGGGAGGAGG - Intronic
1161442596 19:4300774-4300796 GTGTTGGAGGAACAGCGAGGAGG + Intronic
1161488315 19:4547844-4547866 GTGTTGGAAGAACAGCAAGGTGG - Intronic
1161534747 19:4812045-4812067 GTGTTGGAGGAACAGCGAGGAGG - Intergenic
1161624715 19:5319679-5319701 GTGTTGGAGGAACAGCGAGGAGG - Intronic
1161644519 19:5444772-5444794 GTATTGGAGGAACAGCCGGGAGG - Intergenic
1161649891 19:5477987-5478009 GTGTTGGAGGAACAGCGAGGGGG - Intergenic
1161684796 19:5697459-5697481 GTGTTAGAAGAACAGTGAGGAGG + Intronic
1161760587 19:6168205-6168227 GTGTTGGAGGAACAGCAAGGAGG - Intronic
1161985772 19:7652982-7653004 GTGTTTGAAGAACAGCAGCCAGG - Intergenic
1162394699 19:10410246-10410268 GTGTTTGAAGAACAACAAAGGGG + Intronic
1162463577 19:10827964-10827986 GTGTTTGAACAGAAGCCAGGTGG + Intronic
1162601725 19:11674765-11674787 GTGTTTGAAACATAGCCTGGAGG - Intergenic
1162679767 19:12332078-12332100 TTGTTTGAAATACAGCCTGGGGG + Intronic
1163518587 19:17779211-17779233 CTGTCTGAAGAACAGCAAGGAGG + Intronic
1163549475 19:17957607-17957629 GTGTTTGAGGAACAGTGAGGAGG + Intronic
1163822333 19:19503031-19503053 GTGTTTGAAGAACAACCAGTGGG + Intronic
1166327576 19:42060656-42060678 GTGTGTGCAGAACAGCAAGGAGG - Intronic
1166875577 19:45895214-45895236 GTGTTTGAGGATCAGCAAGGAGG - Intronic
1167565298 19:50252350-50252372 ATGTTTGAGGAACAGTGCGGAGG + Intronic
1168053765 19:53849318-53849340 GTGTATGAAAAACAGCGCAGCGG - Intergenic
927272098 2:21222697-21222719 GTGTTTGAATAATAGCAAGGAGG + Intergenic
928490255 2:31776504-31776526 ATGTTTGAGGAACAGCAAGGGGG - Intergenic
929782965 2:44969533-44969555 GTGCTTGAGGAACAGCAAGGGGG + Intergenic
930216372 2:48701410-48701432 GTATTTGAAGAACAGCAAGGAGG - Intronic
931529519 2:63198512-63198534 GTGTTGGAGGAAGAGCCTGGTGG + Intronic
932235665 2:70119286-70119308 GTGTTTTAAGAACAGCAAGGAGG + Intergenic
935759447 2:106306490-106306512 GTGTTGGAAGAGGAGCCTGGTGG + Intergenic
941359153 2:164530669-164530691 ATGTTTGAAATACAGCCAGGAGG + Intronic
942989753 2:182185940-182185962 GAGTTTCAAGAACAACCTGGTGG - Exonic
943272605 2:185826378-185826400 ATGTTTGAGGAACAGCAAGGAGG - Intronic
945224845 2:207523107-207523129 GTGTTTGAGAAACAGCAAGGAGG + Intergenic
946523946 2:220497540-220497562 TTGCATGAAGAACAGCCAGGAGG + Intergenic
946960453 2:224979563-224979585 GTGTTAGAAGAACAGAAAGGAGG - Intronic
947528128 2:230891819-230891841 GTGGTGGTAGAACAGCCCCGAGG + Intergenic
947695470 2:232183743-232183765 GTTTTTGATGAACACCCCTGGGG + Intronic
948712104 2:239831577-239831599 AGCTTTGCAGAACAGCCCGGAGG + Intergenic
1168833024 20:857721-857743 GTGTTTGAGGAACAGCATGGAGG + Intergenic
1168980425 20:1998871-1998893 GTGTTTGAGGAGCAGCAGGGAGG - Intergenic
1169717423 20:8635815-8635837 GTTTTTGATGAATGGCCCGGAGG - Intronic
1172228961 20:33324105-33324127 GTGTGTGATGGACAGCCCAGCGG - Intergenic
1173853726 20:46236036-46236058 GTGTTTGAGGAATAGCACGGAGG - Intronic
1173922316 20:46755557-46755579 GTGTTTAAGGAACAGCAAGGAGG - Intergenic
1174112703 20:48207182-48207204 GTGTTTGAGGAACAGCAATGAGG - Intergenic
1174570673 20:51498984-51499006 GTGTTTGAGGAATAGCACAGAGG + Intronic
1174828884 20:53794764-53794786 TTGGTTGAAGAACAGCCAGAAGG - Intergenic
1175314583 20:58038565-58038587 GTGTTTGAGGATCAGCAAGGGGG - Intergenic
1177836161 21:26188499-26188521 GTGTTTGGAGAACAGCGAGGTGG + Intergenic
1179724000 21:43331605-43331627 GGTTTTGGAGAACAGCCCAGGGG + Intergenic
1181340575 22:22176434-22176456 GTGTTTGAAAAACAACTCAGGGG - Intergenic
1184261544 22:43320089-43320111 GTGTCAGAAGAAGAGCCTGGTGG + Intronic
953091620 3:39732725-39732747 GTGGTTGAAGATCAGCCAGAAGG + Intergenic
954075954 3:48180540-48180562 GTGTCTGGAGAACAGACAGGCGG - Intronic
959689442 3:109182725-109182747 ATGTTTGAAGAGCAGCAAGGGGG - Intergenic
960129735 3:114043255-114043277 GTGTTGGAAAAACAGCAAGGAGG + Intronic
960694268 3:120380599-120380621 GGATTTGAGGAACAGCCAGGAGG + Intergenic
963908642 3:150795701-150795723 GTGTTTGAATAACAGGACCGTGG + Intergenic
964407169 3:156361190-156361212 CTGTTAGAGGAACATCCCGGGGG - Intronic
964821029 3:160769593-160769615 GTGTTTGGAGAACAACAAGGTGG + Intronic
966425870 3:179779062-179779084 ATGTTTGAGGAGGAGCCCGGAGG + Intronic
966904968 3:184515395-184515417 GGGTTTGAAGAACAGCAAGAAGG - Intronic
967679993 3:192350665-192350687 GTGTTTGAGGAACAGCAAGATGG + Intronic
970760140 4:19475828-19475850 GTGTTTGAAAAACAGCAAGGAGG + Intergenic
971255383 4:25009265-25009287 CTGTTTGAAGAACATCCAGGGGG - Intronic
971268826 4:25118258-25118280 GTGTTTGAGGAACAGCAAGATGG + Intergenic
973236440 4:47911816-47911838 GTGCTTGAAGAAAATCCCTGTGG - Intronic
973283817 4:48392552-48392574 ATGTTTGAAGAACAGAACGTAGG - Intronic
974444358 4:61960427-61960449 ATGTTAGCAGAACAGGCCGGAGG + Intronic
975053171 4:69892336-69892358 GTGTTGGAGGAATAGCCTGGTGG + Intergenic
976410105 4:84703564-84703586 ATGTTCGAGGAGCAGCCCGGGGG - Intronic
977982157 4:103336910-103336932 GTGTTTGAAGAACAACAAAGGGG + Intergenic
978144165 4:105352504-105352526 GTGTTTGAAGGATAGACGGGAGG - Intergenic
978567084 4:110094601-110094623 ATGTTTGAGGAACAGCAAGGAGG + Intronic
979024910 4:115558320-115558342 ATATTTGAAGAATAGCCAGGAGG - Intergenic
979122560 4:116921403-116921425 GTGTTTGAGGAGGGGCCCGGTGG + Intergenic
980864243 4:138535920-138535942 GTGTTTGAAGAAAGGCCTTGTGG + Intergenic
981403539 4:144341211-144341233 ATGTTTGAAGAACAGCACCAAGG - Intergenic
981911478 4:149986509-149986531 GGTTTTAAAGAACAGTCCGGAGG - Intergenic
984988215 4:185351950-185351972 GTGTTTATGGAACAGGCCGGAGG + Intronic
985205560 4:187531487-187531509 GTGTTTGAAGGACAGACCTGTGG + Intergenic
986262165 5:6156897-6156919 TTGTTGGAATAACAGCCCAGTGG - Intergenic
988901851 5:35741422-35741444 GTGTTTGAAGAACAGCAAGGAGG + Intronic
990759439 5:59112219-59112241 GTGCTTGAAGATCAGCAAGGAGG + Intronic
991328639 5:65466295-65466317 GTGTTTGAGGAACAGCATGGAGG - Intronic
992739665 5:79760685-79760707 GTGTTGGAGGAAGAGCCTGGTGG - Intronic
993302778 5:86232679-86232701 GTGTTTTAAGAATAGCCTTGGGG - Intergenic
996510912 5:124315049-124315071 GTGTTGGAAGAATGGCCTGGTGG - Intergenic
997121514 5:131178229-131178251 GTATTTGCAGAACAGACTGGAGG + Intronic
998714938 5:144872397-144872419 GTGTTTTCAGAACAGCAAGGAGG + Intergenic
998736157 5:145143598-145143620 GTGTTTGAAGGAGAGCACTGGGG - Intergenic
998794519 5:145804033-145804055 GGGTTAGAAGAACAGCTCAGAGG - Intronic
999681297 5:154062804-154062826 GTGTTAGAGGAACAGCAAGGAGG - Intronic
1000287358 5:159838168-159838190 GTGTTTGAAGGACAGCAAGAAGG - Intergenic
1001751786 5:174137033-174137055 ATGTTGGAGGGACAGCCCGGAGG + Intronic
1003976071 6:11345904-11345926 GTGTTCGAGGAACAACCAGGAGG - Intronic
1004088893 6:12479352-12479374 GGGTTTGAATAACAGACCGTAGG - Intergenic
1005164670 6:22906208-22906230 GTGTATCAAGTACAGCACGGTGG - Intergenic
1005903160 6:30237134-30237156 GTGTATGAATAACAGACCTGTGG + Intergenic
1005964563 6:30717740-30717762 CAGTTTGGAGAACAGCCCGTAGG + Exonic
1006333068 6:33405901-33405923 CTGGTTGAGGAACAGCCAGGAGG - Intronic
1006753320 6:36393317-36393339 GTGTTTGAAGAATGGCAAGGAGG - Intronic
1006977773 6:38119700-38119722 GTGTTTGGACGACAGCCCTGGGG - Intronic
1007440847 6:41858591-41858613 GTGTTGGAAGAACAGTGAGGAGG - Intronic
1010473012 6:76252065-76252087 GTGTTCGAGGAACAGCAAGGAGG + Intergenic
1017379335 6:153810333-153810355 GTGTTTGAAGAGGGGCCTGGTGG + Intergenic
1018710942 6:166497830-166497852 GTGTGTGATGCACAGGCCGGAGG + Intronic
1018972937 6:168540998-168541020 GTGTTACCAGAACAGCCCAGTGG - Intronic
1021466054 7:20944672-20944694 GTGTTGGAGGAACAGCCAGGAGG + Intergenic
1021623038 7:22566326-22566348 GTGTCTGGGGAACAGCCAGGTGG - Intronic
1023531663 7:41162993-41163015 GTGTTTAAAAAGCAGCCCTGGGG + Intergenic
1029136760 7:98378430-98378452 CTGTTTGGAGAACAGCCCGGAGG - Intronic
1029359856 7:100080854-100080876 GTGTTTGATGGACAGTCGGGTGG - Intronic
1029485647 7:100838377-100838399 TTGTCTGAGGAACAGCCCAGAGG + Intronic
1029504540 7:100954801-100954823 GTGATTGAAGAACTGACGGGGGG - Exonic
1030723714 7:112899836-112899858 GTGTTTGAAGAATAGCTTTGCGG - Intronic
1031026608 7:116686269-116686291 GTGTCTGAAGCACAGCAAGGGGG - Intronic
1031945343 7:127833656-127833678 GTGTGGGCAGAACAGCCTGGGGG + Intronic
1031990426 7:128194570-128194592 GAGTTTGAAGAACAGCAAGGAGG + Intergenic
1032418931 7:131762192-131762214 GTGTTTGAGAAACAGCAAGGAGG + Intergenic
1033409816 7:141107161-141107183 GTGTTTGAGAAACAGCCAGAAGG + Intronic
1033447580 7:141436381-141436403 GGGGTTGCAGAACAGCCTGGAGG - Intronic
1034137482 7:148784246-148784268 CTGTTTGAAAAACAGCCAGTGGG - Intronic
1035339709 7:158152436-158152458 GGGTTGGAAGAACAGACAGGAGG + Intronic
1038632148 8:29256057-29256079 GTGTCTGAAGTGCAGCCAGGTGG - Intronic
1039687803 8:39825091-39825113 GTGTTTGGAAAACAGCTAGGAGG - Intronic
1039749510 8:40464071-40464093 GTGTACGAAGGCCAGCCCGGTGG - Intergenic
1041871248 8:62637218-62637240 ATCTTTGAAGAACATCCCTGAGG + Intronic
1043196902 8:77306502-77306524 ATGTTTGAAGAATAGCAAGGGGG + Intergenic
1045326345 8:101120298-101120320 ATATTTGAAGAACAGACCTGAGG - Intergenic
1045685395 8:104706188-104706210 ATGTTTGAAGAATAGCAAGGAGG - Intronic
1048971968 8:139650213-139650235 CTGTTTGAAGAACAGACTGTAGG + Intronic
1049934897 9:492089-492111 GTGTTCCAGGAACAGCCAGGAGG + Intronic
1050174624 9:2856895-2856917 TTGTTTGAAGAACAGCAAGAAGG + Intergenic
1052841184 9:33292102-33292124 GTGTTTGAAGAAGAATTCGGTGG + Intronic
1053010857 9:34632319-34632341 GTGTTGGAAGAAAAGCAAGGAGG + Intergenic
1054870119 9:70041816-70041838 GTGTTTGAGGATCAGCCAAGAGG + Intergenic
1058493085 9:105523325-105523347 GTGTCTGAAGAACAGCGTGGTGG - Intronic
1060385820 9:123227370-123227392 CTGTTTGAAGAAGAGCAAGGAGG + Intronic
1061680786 9:132241622-132241644 GCGTCTGAAGAACAGCACCGAGG + Intronic
1186545492 X:10444929-10444951 GTGTGTGAAGCACTGCCCTGGGG - Intergenic
1189560968 X:42191232-42191254 ATGTTTGAAGAATAGCAAGGAGG + Intergenic
1189711525 X:43817698-43817720 GTGTCTAAAGAACAGCAGGGAGG - Intronic
1190310014 X:49110571-49110593 ATGTGTGAGGAACAGCCGGGAGG - Intergenic
1190855188 X:54287320-54287342 ATGTTTGGAAAACAGCCAGGAGG - Intronic
1191674620 X:63781857-63781879 TTGTTTAAAGAACAGCAAGGAGG - Intronic
1192425399 X:71070565-71070587 GTGTCTGTAGAACATCCAGGTGG + Intronic
1195345833 X:103950323-103950345 TTGTTTGAGGAACAGCAGGGAGG + Intronic
1195361765 X:104089114-104089136 TTGTTTGAGGAACAGCAGGGAGG - Intergenic
1195525169 X:105879722-105879744 GTGTTTGAAGAAGAGTCCAGTGG + Intronic
1195945444 X:110205619-110205641 CTGTTTGAAGTACAGCCAGGTGG + Intronic
1196021635 X:110997109-110997131 ATGTTTGAAGAACAGCAAGGGGG + Intronic
1196073703 X:111551635-111551657 GTGTTGGAAGAACAGCAGGAAGG - Intergenic
1196130482 X:112150063-112150085 GTGTTTTAAGAACAGTGAGGAGG + Intergenic
1196706558 X:118722322-118722344 TTGTGTGAAGAACAGCCAGGTGG + Intergenic
1197957864 X:131972273-131972295 GTGTTTGAGGTACAGCAAGGTGG + Intergenic
1199059334 X:143335686-143335708 ATGTTTGAGGAACAGCAAGGAGG - Intergenic
1200551939 Y:4589428-4589450 GTGTTTGAGGAAGGGCCTGGTGG - Intergenic
1202097814 Y:21272090-21272112 GTGTTGGAAGAAGAGCCTGGTGG - Intergenic