ID: 1128532204

View in Genome Browser
Species Human (GRCh38)
Location 15:68462065-68462087
Sequence CCAGAGCCTGCACCTTGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128532194_1128532204 8 Left 1128532194 15:68462034-68462056 CCAGGCACACTCAGACACCTGTG No data
Right 1128532204 15:68462065-68462087 CCAGAGCCTGCACCTTGGTGTGG No data
1128532193_1128532204 16 Left 1128532193 15:68462026-68462048 CCTCTCAGCCAGGCACACTCAGA No data
Right 1128532204 15:68462065-68462087 CCAGAGCCTGCACCTTGGTGTGG No data
1128532196_1128532204 -9 Left 1128532196 15:68462051-68462073 CCTGTGGCCCCCACCCAGAGCCT No data
Right 1128532204 15:68462065-68462087 CCAGAGCCTGCACCTTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128532204 Original CRISPR CCAGAGCCTGCACCTTGGTG TGG Intergenic
No off target data available for this crispr