ID: 1128532742

View in Genome Browser
Species Human (GRCh38)
Location 15:68465633-68465655
Sequence GAGAACTGGCTGAAGACTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128532742_1128532749 5 Left 1128532742 15:68465633-68465655 CCACCAGTCTTCAGCCAGTTCTC No data
Right 1128532749 15:68465661-68465683 CCACACTCCCTCCCATTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128532742 Original CRISPR GAGAACTGGCTGAAGACTGG TGG (reversed) Intergenic
No off target data available for this crispr