ID: 1128533405

View in Genome Browser
Species Human (GRCh38)
Location 15:68470741-68470763
Sequence CCCCGACCTTAGGCCTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128533405_1128533409 -4 Left 1128533405 15:68470741-68470763 CCAGAGGAGGCCTAAGGTCGGGG No data
Right 1128533409 15:68470760-68470782 GGGGGACACTTAACTCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128533405 Original CRISPR CCCCGACCTTAGGCCTCCTC TGG (reversed) Intergenic
No off target data available for this crispr