ID: 1128536247

View in Genome Browser
Species Human (GRCh38)
Location 15:68492885-68492907
Sequence GCATGAACACTGATGGGTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128536247_1128536253 14 Left 1128536247 15:68492885-68492907 CCGTGACCCATCAGTGTTCATGC No data
Right 1128536253 15:68492922-68492944 CCTCTTGCCTCCTGCCCTGCAGG No data
1128536247_1128536250 -9 Left 1128536247 15:68492885-68492907 CCGTGACCCATCAGTGTTCATGC No data
Right 1128536250 15:68492899-68492921 TGTTCATGCAGTCCTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128536247 Original CRISPR GCATGAACACTGATGGGTCA CGG (reversed) Intergenic
No off target data available for this crispr