ID: 1128536437

View in Genome Browser
Species Human (GRCh38)
Location 15:68494182-68494204
Sequence CAGAGGAAGCATTCTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128536437_1128536440 -6 Left 1128536437 15:68494182-68494204 CCTTCCTCAGAATGCTTCCTCTG No data
Right 1128536440 15:68494199-68494221 CCTCTGTTCCAACTGAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128536437 Original CRISPR CAGAGGAAGCATTCTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr