ID: 1128537758

View in Genome Browser
Species Human (GRCh38)
Location 15:68503540-68503562
Sequence GACCTGGATTTTCCTCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128537755_1128537758 -2 Left 1128537755 15:68503519-68503541 CCTTCCTCGAAGAGAGCTCTCGA No data
Right 1128537758 15:68503540-68503562 GACCTGGATTTTCCTCCCTCTGG No data
1128537754_1128537758 11 Left 1128537754 15:68503506-68503528 CCTCTGGATGCAGCCTTCCTCGA No data
Right 1128537758 15:68503540-68503562 GACCTGGATTTTCCTCCCTCTGG No data
1128537756_1128537758 -6 Left 1128537756 15:68503523-68503545 CCTCGAAGAGAGCTCTCGACCTG No data
Right 1128537758 15:68503540-68503562 GACCTGGATTTTCCTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128537758 Original CRISPR GACCTGGATTTTCCTCCCTC TGG Intergenic
No off target data available for this crispr