ID: 1128542230

View in Genome Browser
Species Human (GRCh38)
Location 15:68544088-68544110
Sequence CTGTCTACAGAGCTTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128542230_1128542237 28 Left 1128542230 15:68544088-68544110 CCTTCCCCAAGCTCTGTAGACAG No data
Right 1128542237 15:68544139-68544161 GAGGTGCTGATGGTCCACTGTGG No data
1128542230_1128542235 9 Left 1128542230 15:68544088-68544110 CCTTCCCCAAGCTCTGTAGACAG No data
Right 1128542235 15:68544120-68544142 CAGTGCAGTGATCAGAACAGAGG No data
1128542230_1128542236 18 Left 1128542230 15:68544088-68544110 CCTTCCCCAAGCTCTGTAGACAG No data
Right 1128542236 15:68544129-68544151 GATCAGAACAGAGGTGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128542230 Original CRISPR CTGTCTACAGAGCTTGGGGA AGG (reversed) Intergenic
No off target data available for this crispr