ID: 1128543277

View in Genome Browser
Species Human (GRCh38)
Location 15:68551417-68551439
Sequence CTCTTCACCCACAGCCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128543277_1128543284 21 Left 1128543277 15:68551417-68551439 CCCACTGGGCTGTGGGTGAAGAG No data
Right 1128543284 15:68551461-68551483 CCCGGAGGCTGTCCCCAAGCTGG No data
1128543277_1128543281 6 Left 1128543277 15:68551417-68551439 CCCACTGGGCTGTGGGTGAAGAG No data
Right 1128543281 15:68551446-68551468 CTCACCACAACTGTTCCCGGAGG No data
1128543277_1128543280 3 Left 1128543277 15:68551417-68551439 CCCACTGGGCTGTGGGTGAAGAG No data
Right 1128543280 15:68551443-68551465 CAGCTCACCACAACTGTTCCCGG No data
1128543277_1128543286 22 Left 1128543277 15:68551417-68551439 CCCACTGGGCTGTGGGTGAAGAG No data
Right 1128543286 15:68551462-68551484 CCGGAGGCTGTCCCCAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128543277 Original CRISPR CTCTTCACCCACAGCCCAGT GGG (reversed) Intergenic