ID: 1128545778

View in Genome Browser
Species Human (GRCh38)
Location 15:68566651-68566673
Sequence CTGTGGTTAAGGAGCAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128545762_1128545778 20 Left 1128545762 15:68566608-68566630 CCACACCCCTCACTCTGCCCCAT No data
Right 1128545778 15:68566651-68566673 CTGTGGTTAAGGAGCAAATAAGG No data
1128545772_1128545778 -10 Left 1128545772 15:68566638-68566660 CCACAGGCCTCCCCTGTGGTTAA No data
Right 1128545778 15:68566651-68566673 CTGTGGTTAAGGAGCAAATAAGG No data
1128545765_1128545778 13 Left 1128545765 15:68566615-68566637 CCTCACTCTGCCCCATTCCTGCT No data
Right 1128545778 15:68566651-68566673 CTGTGGTTAAGGAGCAAATAAGG No data
1128545763_1128545778 15 Left 1128545763 15:68566613-68566635 CCCCTCACTCTGCCCCATTCCTG No data
Right 1128545778 15:68566651-68566673 CTGTGGTTAAGGAGCAAATAAGG No data
1128545769_1128545778 1 Left 1128545769 15:68566627-68566649 CCATTCCTGCTCCACAGGCCTCC No data
Right 1128545778 15:68566651-68566673 CTGTGGTTAAGGAGCAAATAAGG No data
1128545761_1128545778 21 Left 1128545761 15:68566607-68566629 CCCACACCCCTCACTCTGCCCCA No data
Right 1128545778 15:68566651-68566673 CTGTGGTTAAGGAGCAAATAAGG No data
1128545764_1128545778 14 Left 1128545764 15:68566614-68566636 CCCTCACTCTGCCCCATTCCTGC No data
Right 1128545778 15:68566651-68566673 CTGTGGTTAAGGAGCAAATAAGG No data
1128545767_1128545778 3 Left 1128545767 15:68566625-68566647 CCCCATTCCTGCTCCACAGGCCT No data
Right 1128545778 15:68566651-68566673 CTGTGGTTAAGGAGCAAATAAGG No data
1128545770_1128545778 -4 Left 1128545770 15:68566632-68566654 CCTGCTCCACAGGCCTCCCCTGT No data
Right 1128545778 15:68566651-68566673 CTGTGGTTAAGGAGCAAATAAGG No data
1128545768_1128545778 2 Left 1128545768 15:68566626-68566648 CCCATTCCTGCTCCACAGGCCTC No data
Right 1128545778 15:68566651-68566673 CTGTGGTTAAGGAGCAAATAAGG No data
1128545759_1128545778 27 Left 1128545759 15:68566601-68566623 CCTGTCCCCACACCCCTCACTCT No data
Right 1128545778 15:68566651-68566673 CTGTGGTTAAGGAGCAAATAAGG No data
1128545760_1128545778 22 Left 1128545760 15:68566606-68566628 CCCCACACCCCTCACTCTGCCCC No data
Right 1128545778 15:68566651-68566673 CTGTGGTTAAGGAGCAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128545778 Original CRISPR CTGTGGTTAAGGAGCAAATA AGG Intergenic
No off target data available for this crispr