ID: 1128547332

View in Genome Browser
Species Human (GRCh38)
Location 15:68577334-68577356
Sequence AACGGATTTAGAGAAGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128547332_1128547340 1 Left 1128547332 15:68577334-68577356 CCCTTCCCTTCTCTAAATCCGTT No data
Right 1128547340 15:68577358-68577380 ACTCATCAGCAAAATGGGGACGG No data
1128547332_1128547337 -5 Left 1128547332 15:68577334-68577356 CCCTTCCCTTCTCTAAATCCGTT No data
Right 1128547337 15:68577352-68577374 CCGTTTACTCATCAGCAAAATGG No data
1128547332_1128547338 -4 Left 1128547332 15:68577334-68577356 CCCTTCCCTTCTCTAAATCCGTT No data
Right 1128547338 15:68577353-68577375 CGTTTACTCATCAGCAAAATGGG No data
1128547332_1128547339 -3 Left 1128547332 15:68577334-68577356 CCCTTCCCTTCTCTAAATCCGTT No data
Right 1128547339 15:68577354-68577376 GTTTACTCATCAGCAAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128547332 Original CRISPR AACGGATTTAGAGAAGGGAA GGG (reversed) Intergenic
No off target data available for this crispr