ID: 1128547335

View in Genome Browser
Species Human (GRCh38)
Location 15:68577340-68577362
Sequence TGAGTAAACGGATTTAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128547335_1128547340 -5 Left 1128547335 15:68577340-68577362 CCTTCTCTAAATCCGTTTACTCA No data
Right 1128547340 15:68577358-68577380 ACTCATCAGCAAAATGGGGACGG No data
1128547335_1128547341 25 Left 1128547335 15:68577340-68577362 CCTTCTCTAAATCCGTTTACTCA No data
Right 1128547341 15:68577388-68577410 TTCCTCACACTGTTGCATTTAGG No data
1128547335_1128547339 -9 Left 1128547335 15:68577340-68577362 CCTTCTCTAAATCCGTTTACTCA No data
Right 1128547339 15:68577354-68577376 GTTTACTCATCAGCAAAATGGGG No data
1128547335_1128547338 -10 Left 1128547335 15:68577340-68577362 CCTTCTCTAAATCCGTTTACTCA No data
Right 1128547338 15:68577353-68577375 CGTTTACTCATCAGCAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128547335 Original CRISPR TGAGTAAACGGATTTAGAGA AGG (reversed) Intergenic
No off target data available for this crispr