ID: 1128547340

View in Genome Browser
Species Human (GRCh38)
Location 15:68577358-68577380
Sequence ACTCATCAGCAAAATGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128547335_1128547340 -5 Left 1128547335 15:68577340-68577362 CCTTCTCTAAATCCGTTTACTCA No data
Right 1128547340 15:68577358-68577380 ACTCATCAGCAAAATGGGGACGG No data
1128547332_1128547340 1 Left 1128547332 15:68577334-68577356 CCCTTCCCTTCTCTAAATCCGTT No data
Right 1128547340 15:68577358-68577380 ACTCATCAGCAAAATGGGGACGG No data
1128547334_1128547340 -4 Left 1128547334 15:68577339-68577361 CCCTTCTCTAAATCCGTTTACTC No data
Right 1128547340 15:68577358-68577380 ACTCATCAGCAAAATGGGGACGG No data
1128547333_1128547340 0 Left 1128547333 15:68577335-68577357 CCTTCCCTTCTCTAAATCCGTTT No data
Right 1128547340 15:68577358-68577380 ACTCATCAGCAAAATGGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128547340 Original CRISPR ACTCATCAGCAAAATGGGGA CGG Intergenic
No off target data available for this crispr