ID: 1128547453

View in Genome Browser
Species Human (GRCh38)
Location 15:68578027-68578049
Sequence TCTCCGCGGTTCTGTATCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128547439_1128547453 30 Left 1128547439 15:68577974-68577996 CCTGCTTGGAGAACCCCTCTGCT No data
Right 1128547453 15:68578027-68578049 TCTCCGCGGTTCTGTATCTGCGG No data
1128547444_1128547453 3 Left 1128547444 15:68578001-68578023 CCTCTGCTAACTCCTCCCCTCCA No data
Right 1128547453 15:68578027-68578049 TCTCCGCGGTTCTGTATCTGCGG No data
1128547442_1128547453 15 Left 1128547442 15:68577989-68578011 CCTCTGCTTCCACCTCTGCTAAC No data
Right 1128547453 15:68578027-68578049 TCTCCGCGGTTCTGTATCTGCGG No data
1128547440_1128547453 17 Left 1128547440 15:68577987-68578009 CCCCTCTGCTTCCACCTCTGCTA No data
Right 1128547453 15:68578027-68578049 TCTCCGCGGTTCTGTATCTGCGG No data
1128547443_1128547453 6 Left 1128547443 15:68577998-68578020 CCACCTCTGCTAACTCCTCCCCT No data
Right 1128547453 15:68578027-68578049 TCTCCGCGGTTCTGTATCTGCGG No data
1128547441_1128547453 16 Left 1128547441 15:68577988-68578010 CCCTCTGCTTCCACCTCTGCTAA No data
Right 1128547453 15:68578027-68578049 TCTCCGCGGTTCTGTATCTGCGG No data
1128547445_1128547453 -9 Left 1128547445 15:68578013-68578035 CCTCCCCTCCACCCTCTCCGCGG No data
Right 1128547453 15:68578027-68578049 TCTCCGCGGTTCTGTATCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128547453 Original CRISPR TCTCCGCGGTTCTGTATCTG CGG Intergenic
No off target data available for this crispr