ID: 1128547864

View in Genome Browser
Species Human (GRCh38)
Location 15:68579605-68579627
Sequence CCCGCCGCGCACTCCCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 91}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128547864_1128547873 12 Left 1128547864 15:68579605-68579627 CCCTCCAGGGAGTGCGCGGCGGG 0: 1
1: 0
2: 1
3: 3
4: 91
Right 1128547873 15:68579640-68579662 CAGGGGCTGGTGCTGAGCAGTGG 0: 1
1: 2
2: 12
3: 88
4: 718
1128547864_1128547878 24 Left 1128547864 15:68579605-68579627 CCCTCCAGGGAGTGCGCGGCGGG 0: 1
1: 0
2: 1
3: 3
4: 91
Right 1128547878 15:68579652-68579674 CTGAGCAGTGGGTGTGGGGATGG 0: 1
1: 0
2: 9
3: 107
4: 844
1128547864_1128547877 20 Left 1128547864 15:68579605-68579627 CCCTCCAGGGAGTGCGCGGCGGG 0: 1
1: 0
2: 1
3: 3
4: 91
Right 1128547877 15:68579648-68579670 GGTGCTGAGCAGTGGGTGTGGGG 0: 1
1: 0
2: 3
3: 61
4: 501
1128547864_1128547876 19 Left 1128547864 15:68579605-68579627 CCCTCCAGGGAGTGCGCGGCGGG 0: 1
1: 0
2: 1
3: 3
4: 91
Right 1128547876 15:68579647-68579669 TGGTGCTGAGCAGTGGGTGTGGG 0: 1
1: 0
2: 2
3: 44
4: 374
1128547864_1128547870 -6 Left 1128547864 15:68579605-68579627 CCCTCCAGGGAGTGCGCGGCGGG 0: 1
1: 0
2: 1
3: 3
4: 91
Right 1128547870 15:68579622-68579644 GGCGGGAAGCGTCGCTGGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 82
1128547864_1128547874 13 Left 1128547864 15:68579605-68579627 CCCTCCAGGGAGTGCGCGGCGGG 0: 1
1: 0
2: 1
3: 3
4: 91
Right 1128547874 15:68579641-68579663 AGGGGCTGGTGCTGAGCAGTGGG 0: 1
1: 0
2: 3
3: 56
4: 380
1128547864_1128547875 18 Left 1128547864 15:68579605-68579627 CCCTCCAGGGAGTGCGCGGCGGG 0: 1
1: 0
2: 1
3: 3
4: 91
Right 1128547875 15:68579646-68579668 CTGGTGCTGAGCAGTGGGTGTGG 0: 1
1: 1
2: 8
3: 71
4: 508
1128547864_1128547869 -7 Left 1128547864 15:68579605-68579627 CCCTCCAGGGAGTGCGCGGCGGG 0: 1
1: 0
2: 1
3: 3
4: 91
Right 1128547869 15:68579621-68579643 CGGCGGGAAGCGTCGCTGGCAGG 0: 1
1: 0
2: 1
3: 3
4: 101
1128547864_1128547872 -1 Left 1128547864 15:68579605-68579627 CCCTCCAGGGAGTGCGCGGCGGG 0: 1
1: 0
2: 1
3: 3
4: 91
Right 1128547872 15:68579627-68579649 GAAGCGTCGCTGGCAGGGGCTGG 0: 1
1: 0
2: 4
3: 22
4: 305
1128547864_1128547871 -5 Left 1128547864 15:68579605-68579627 CCCTCCAGGGAGTGCGCGGCGGG 0: 1
1: 0
2: 1
3: 3
4: 91
Right 1128547871 15:68579623-68579645 GCGGGAAGCGTCGCTGGCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 107
1128547864_1128547879 25 Left 1128547864 15:68579605-68579627 CCCTCCAGGGAGTGCGCGGCGGG 0: 1
1: 0
2: 1
3: 3
4: 91
Right 1128547879 15:68579653-68579675 TGAGCAGTGGGTGTGGGGATGGG 0: 1
1: 0
2: 8
3: 79
4: 628

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128547864 Original CRISPR CCCGCCGCGCACTCCCTGGA GGG (reversed) Intronic
901373173 1:8817699-8817721 CCCGCCGCCCACTCCCCGCTCGG + Intergenic
904063160 1:27726483-27726505 GCCGCCGCGGTCTCCCTGGTGGG + Intronic
904359570 1:29963054-29963076 TCCACCACCCACTCCCTGGAAGG + Intergenic
905803717 1:40861736-40861758 CCGCCCGCGCACGCCCTGGGCGG - Exonic
905881501 1:41467202-41467224 GCCTCCCTGCACTCCCTGGAAGG + Intergenic
910669994 1:89763088-89763110 GCCGCCGCTCACTCCAGGGAGGG - Intronic
912625874 1:111204266-111204288 CCCCCCGCGCTCTCCCCGGCCGG + Intronic
922583041 1:226712622-226712644 CTAGCCCTGCACTCCCTGGACGG + Intronic
922705640 1:227788721-227788743 CCCGCCGCGGAGTCCCGGGCCGG + Intergenic
923674116 1:236065241-236065263 CCCGCGGCGCGCCCGCTGGACGG - Intergenic
1064167774 10:13001530-13001552 CTCGCCGCGCTCTGCCTGGCGGG - Exonic
1075800860 10:125152327-125152349 CTGGCCGCGCTCTACCTGGAGGG - Intronic
1076726395 10:132416148-132416170 CCCGCCGAGAAGTCACTGGAGGG - Intronic
1076792934 10:132786272-132786294 CCGGCCGCGCACTCCATGAAGGG + Intergenic
1076806363 10:132861157-132861179 CCGCCCTCGCACTCCCTGGCAGG + Intronic
1077006167 11:358288-358310 CCCACCCCGCGCTCTCTGGAAGG - Intergenic
1080458480 11:32435083-32435105 CCCGCCGTCCCCTCCCTGGGTGG - Exonic
1084540377 11:69782607-69782629 CCCCCCTCCCTCTCCCTGGATGG + Intergenic
1084740689 11:71137630-71137652 CCCGCCACCCACTCCCTGGAAGG + Intronic
1085315611 11:75543108-75543130 CCCGCATCGCACGCCCTGCAAGG - Intergenic
1089292295 11:117444545-117444567 CCCGCCCCCTCCTCCCTGGACGG - Intronic
1092163028 12:6326527-6326549 CCCTCCACGCCTTCCCTGGAGGG + Exonic
1093435270 12:19129555-19129577 CCCGCCGCGCGCTCGGGGGATGG - Intergenic
1103789368 12:123458521-123458543 CCCACTGCGCATGCCCTGGAGGG + Intronic
1104602029 12:130161200-130161222 CCCACCGCGAACGCCCTGGGCGG + Intergenic
1104983355 12:132583503-132583525 CCCGCCGCCCCCGCCTTGGACGG + Exonic
1106242058 13:27920424-27920446 CCCGCCGGGCCCTTCCCGGAGGG + Exonic
1106720026 13:32427617-32427639 CCCGCCGCGCTGTCCCGGGGGGG - Intronic
1107468459 13:40669020-40669042 CCCGCCTCGGCCTCCCTGCAAGG - Intergenic
1109370533 13:61415147-61415169 TCGGCCGCGCATTCCCTGGGAGG + Exonic
1112344316 13:98577198-98577220 CCCGCCCCGCGCTTCCGGGAGGG + Intronic
1121074875 14:91060104-91060126 CCCGCCGCTCATTCCCGGGCTGG + Intronic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1128547864 15:68579605-68579627 CCCGCCGCGCACTCCCTGGAGGG - Intronic
1133242859 16:4425966-4425988 CCCACCACGCCCTCCCTGGGCGG - Exonic
1136541953 16:30932665-30932687 CCCGCAGCACAGTGCCTGGAGGG + Intronic
1149347285 17:55751300-55751322 GCCGCCCCGCACTCCCTGCGGGG - Intronic
1152605656 17:81288362-81288384 CCAGCCGCACACTGGCTGGAAGG + Intronic
1154508496 18:15067783-15067805 AGCGCCGAGCATTCCCTGGATGG - Intergenic
1161014908 19:1978740-1978762 CCCGCCGCGCACCAGCTGGATGG - Exonic
1162128613 19:8512236-8512258 CCCGCCCTCAACTCCCTGGATGG - Intronic
1166268612 19:41700272-41700294 CCTGCAGCCCCCTCCCTGGAGGG - Intronic
1166268625 19:41700308-41700330 CCTGCAGCCCCCTCCCTGGAGGG - Intronic
1166268638 19:41700344-41700366 CCTGCAGCCCCCTCCCTGGAGGG - Intronic
1166268651 19:41700380-41700402 CCTGCAGCCCCCTCCCTGGAGGG - Intronic
928149147 2:28810724-28810746 GCCGGCGCGCACTCCCAGGCAGG + Intronic
932213770 2:69953011-69953033 CCCGCTGTGCAGCCCCTGGAGGG - Intergenic
932771404 2:74502743-74502765 CCCGGCCCGCACGCCCGGGAGGG - Intronic
935790712 2:106587583-106587605 CTCGCTGCGCATACCCTGGATGG - Intergenic
942349491 2:175038080-175038102 CCCCCCGCCCACCCCCGGGAAGG - Intergenic
947745770 2:232506594-232506616 CCAGCCTGGCCCTCCCTGGAGGG - Intergenic
947806265 2:232970457-232970479 CCCTCCCCTCACTCCCTGAAGGG + Intronic
948928769 2:241117005-241117027 CCCGCTGCCCTCTGCCTGGAGGG - Intronic
1171127381 20:22614455-22614477 CCCACCGCACAGTCACTGGAAGG + Intergenic
1172277125 20:33685940-33685962 CCCCCCGCGCAGACCCGGGAGGG - Intronic
1176005751 20:62861587-62861609 CCCGCCGCCCGCGCCCTCGACGG + Exonic
1177088968 21:16742256-16742278 CCAGCCAGGAACTCCCTGGAAGG + Intergenic
1180157806 21:45986566-45986588 ACCGACGGGCACCCCCTGGAGGG + Exonic
1181863533 22:25837574-25837596 GCCGGCGCTCACTCACTGGATGG - Intronic
1182277034 22:29196150-29196172 CCCTCCGTGCTCTCCCAGGAGGG - Intergenic
1183942317 22:41302473-41302495 GCCCCCTAGCACTCCCTGGACGG - Intronic
1184713601 22:46267974-46267996 CGCCCCGCCCACTCCCAGGAAGG + Exonic
952956743 3:38562372-38562394 ACCGCCTCCCACTCCCTGGTGGG + Intronic
952959321 3:38579741-38579763 CCCTCCCCAGACTCCCTGGAAGG + Intronic
953925215 3:46979382-46979404 CCCGCCGCCCCTTCCCTGAATGG + Intronic
965558126 3:170038066-170038088 CGCCCCGCGCGCTCCCGGGAGGG - Exonic
967818622 3:193819511-193819533 CATGCCGCGCAGTGCCTGGATGG + Intergenic
985776542 5:1847173-1847195 CCTGCCCCGCACTCCCTGTGAGG + Intergenic
998039775 5:138944791-138944813 CTCGCCACCCTCTCCCTGGAGGG + Intergenic
1001823105 5:174725032-174725054 CCCGGCGCGCACTCACTTGGCGG - Exonic
1001826689 5:174751197-174751219 CCCGCCGCGAGCTCCCGGGGCGG + Intergenic
1003496573 6:6668563-6668585 CCCGTCCCGCACTCCCTGCCAGG - Intergenic
1017719782 6:157236309-157236331 CCCGCCGCGCTCCGCCTGGGTGG - Intergenic
1018739323 6:166715158-166715180 CCCGCCTCGGGCTGCCTGGAGGG - Intronic
1018950667 6:168376929-168376951 ACCGCCCCCCACTTCCTGGAGGG + Intergenic
1019406995 7:889128-889150 CCTCCCATGCACTCCCTGGACGG - Intronic
1019627861 7:2030196-2030218 CCCGCCCCGCGCTCCACGGAAGG + Intronic
1020106600 7:5424983-5425005 CCGGTCTCGCCCTCCCTGGAGGG - Intronic
1021451244 7:20785299-20785321 TCCTCCGCGCACTCGCAGGACGG - Exonic
1024589318 7:50867561-50867583 CACGGCGCTCACTCCCGGGAAGG - Intergenic
1026470982 7:70694150-70694172 GCCGCCGCGGGCTCCCTGGCTGG - Intronic
1029271833 7:99381710-99381732 CCCTGCGCTCACTGCCTGGAAGG - Intronic
1029640731 7:101817334-101817356 CCCGCCGCGCGCTCCATGGCGGG - Intronic
1029737698 7:102473763-102473785 CCCGCCAGGCCCTTCCTGGAGGG + Intronic
1035171722 7:157021041-157021063 CCCGCCGGGCTCTCCCTGCGCGG - Intergenic
1049178040 8:141206112-141206134 CCCGCCCCGCCGTCCCTGGCAGG - Intergenic
1060152834 9:121299744-121299766 CGCCCCGCGCCCTCCCTGGGGGG + Intronic
1061422944 9:130481994-130482016 CCCTCCCAGCTCTCCCTGGAGGG - Intronic
1061896748 9:133652278-133652300 CCCGCTGGGCACTCACCGGATGG - Exonic
1062161584 9:135083359-135083381 CCCTCCGCACTCTCCCTGGCAGG - Intronic
1062208171 9:135348638-135348660 CCCGCCCCCCCCTCCCTGGCAGG + Intergenic
1062349603 9:136132562-136132584 CCCGCCGCCCAGTCCTGGGATGG + Intergenic
1062717316 9:138017765-138017787 CCAGCCAGTCACTCCCTGGAGGG - Intronic
1185469179 X:372463-372485 CCCGCCACGCACACCCTGTCTGG + Intronic
1187164459 X:16791870-16791892 GCCACCGCGCCCTGCCTGGAAGG + Intronic
1197776765 X:130123266-130123288 GCTGCCGCTCACTGCCTGGATGG - Intergenic