ID: 1128548557

View in Genome Browser
Species Human (GRCh38)
Location 15:68583438-68583460
Sequence TGCCCTGGCAAGGGGTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128548545_1128548557 17 Left 1128548545 15:68583398-68583420 CCTCGGTCCTGACTCATGGTCAG 0: 1
1: 0
2: 1
3: 7
4: 101
Right 1128548557 15:68583438-68583460 TGCCCTGGCAAGGGGTCCTGGGG 0: 1
1: 0
2: 0
3: 36
4: 257
1128548546_1128548557 10 Left 1128548546 15:68583405-68583427 CCTGACTCATGGTCAGTGCTCTT 0: 1
1: 0
2: 3
3: 21
4: 234
Right 1128548557 15:68583438-68583460 TGCCCTGGCAAGGGGTCCTGGGG 0: 1
1: 0
2: 0
3: 36
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128548557 Original CRISPR TGCCCTGGCAAGGGGTCCTG GGG Intronic
900129686 1:1082087-1082109 TGCCCTGGCGCTGAGTCCTGGGG - Exonic
900227897 1:1541212-1541234 GTCCCTGGCTCGGGGTCCTGAGG + Intergenic
900241243 1:1618555-1618577 TGCCCAGGGGATGGGTCCTGTGG + Intronic
901043235 1:6378644-6378666 GGCCCTGGTAAGGTCTCCTGTGG + Intronic
901244614 1:7719876-7719898 TGCCCTGGCAGGGAGAGCTGAGG - Intronic
901436601 1:9250579-9250601 TGCCCTGCCAAGGGTTCTGGTGG + Intronic
902005307 1:13227157-13227179 TGCCCAGGCTAGGGGTACAGTGG - Intergenic
902384772 1:16070152-16070174 TGCCCTGGCCATGTGACCTGAGG + Intronic
902396171 1:16133448-16133470 CCCCCTGCCAAGGGGCCCTGAGG - Intronic
902698887 1:18158192-18158214 TGCCATGGCAGGGGGTCCTAAGG - Intronic
902877351 1:19348941-19348963 TGCTCTGGCAAGTCATCCTGAGG + Intronic
902919080 1:19655978-19656000 GGGCCTGGAAAGGGGCCCTGAGG - Intronic
903440675 1:23385762-23385784 TGCCCTGGCATGGGGAACTTGGG - Intronic
903448482 1:23437234-23437256 AGCGCTGGCCCGGGGTCCTGGGG - Exonic
903658036 1:24960750-24960772 TGCATGGGCAAGGGGTCCTCAGG + Intronic
904360411 1:29967609-29967631 GCCCCTGGCAAGGGCACCTGTGG + Intergenic
906885814 1:49647412-49647434 TGCACTGGCACTGGTTCCTGTGG - Intronic
907258487 1:53197800-53197822 TGCACTTACAAGGGGTACTGTGG - Intronic
908251325 1:62268315-62268337 TGCCCAGGAAAGTGGGCCTGGGG - Exonic
908794271 1:67815971-67815993 AGCCCTGGCATGGGGCCCAGAGG - Intronic
912028316 1:105206243-105206265 TGCCCTGGCAGGGGTTGCTGAGG + Intergenic
914993362 1:152517413-152517435 CTCCCTGGCAAGGGGTCATTTGG - Intronic
915087840 1:153400127-153400149 TGCCCTGGCCATGGGTAGTGGGG - Intergenic
916434631 1:164766478-164766500 TGCCCTAGGAAGGGCTCCTGAGG + Intronic
918315087 1:183316601-183316623 TGTCCAGGCACGGGGGCCTGAGG + Intronic
918428704 1:184436529-184436551 TGCTATGTCAAGGGCTCCTGGGG - Intronic
920417829 1:205810552-205810574 AGCCGTGGGAAGAGGTCCTGCGG - Exonic
922025247 1:221743116-221743138 TCCCCTGGCCGGGCGTCCTGGGG + Intergenic
1062814668 10:490576-490598 CGCTCTGGCAGGGGCTCCTGTGG - Intronic
1063159332 10:3408297-3408319 GGGCCTTGCAGGGGGTCCTGTGG + Intergenic
1063159368 10:3408397-3408419 GGGCCTTGCAGGGGGTCCTGTGG + Intergenic
1064312518 10:14224054-14224076 TGCTCAGGCGAGGAGTCCTGTGG + Intronic
1064563026 10:16611242-16611264 TTCCCTGGCAATGGGCCCAGAGG - Intronic
1067225439 10:44373235-44373257 TGCCCTGGCAGGGGAGGCTGTGG + Intronic
1069060000 10:63885421-63885443 TGGCCTGGCAAGTAGTCCTTAGG + Intergenic
1069833387 10:71294395-71294417 TTCCTTGGCAAGGGGCCCTGAGG - Intronic
1071841829 10:89479393-89479415 TGCCCTTGCAAGGAGGCCTGTGG + Intronic
1072902366 10:99419688-99419710 TGGCCTGGCATGGGGTCCACAGG + Intronic
1074266603 10:111910563-111910585 TCCCCTTGCAAGGGGACATGTGG - Intergenic
1074719284 10:116250762-116250784 AGCTATGGCCAGGGGTCCTGAGG - Intronic
1075871566 10:125775089-125775111 TGCTCTGGCACGTGGTCCTTTGG - Intronic
1076794397 10:132791604-132791626 GCCCCTGCCGAGGGGTCCTGTGG - Intergenic
1077315534 11:1917878-1917900 CACCCAGGCCAGGGGTCCTGAGG - Intergenic
1077325064 11:1960150-1960172 TGCCAGGGCATGGGCTCCTGTGG - Intronic
1077392338 11:2305771-2305793 TGCACTGGGCTGGGGTCCTGAGG + Intronic
1078386160 11:10894796-10894818 GACCCTTGCAAGGGGTGCTGGGG + Intergenic
1078852786 11:15179567-15179589 TGCACTGACATGGGGGCCTGTGG - Intronic
1079336740 11:19576865-19576887 TGGCCTGGGAAGGTGTCCTGGGG + Intronic
1081775794 11:45675202-45675224 TGACCTGGAAAGGTGTCCTGTGG - Intergenic
1084979122 11:72819661-72819683 TGTCCTGGGAAGGAGTGCTGGGG - Intronic
1085157721 11:74311599-74311621 AGCGCTGGCTATGGGTCCTGGGG - Exonic
1085417499 11:76329112-76329134 GGCCCTGGAGCGGGGTCCTGGGG - Intergenic
1085618546 11:78020532-78020554 AGCCCTGCCAAGGGGCCTTGAGG - Intronic
1089126869 11:116182561-116182583 TGCCCTGCCACAGTGTCCTGGGG - Intergenic
1090837103 11:130461717-130461739 TGCCCTAAGAAGGGGTCCTAAGG - Intronic
1202808046 11_KI270721v1_random:15329-15351 TGCCAGGGCATGGGCTCCTGTGG - Intergenic
1095777186 12:46023384-46023406 TGGCCTGGCAGGGGGAGCTGGGG - Intergenic
1096771479 12:53938629-53938651 TGCCCCGGCCAGGTCTCCTGGGG - Intergenic
1096914555 12:55017493-55017515 TCTCCTGGCAAAGGGTCCTTGGG + Intergenic
1097532288 12:60818361-60818383 TGCCCAGGCCTGGGGTCATGTGG + Intergenic
1097805623 12:63961551-63961573 TGTCCTGGTCAGGAGTCCTGAGG - Intronic
1102171670 12:110847142-110847164 TTCCCTGGCAGGGGGAGCTGTGG - Intronic
1102370791 12:112381578-112381600 TGCCCTGGAAGTGGGTCCTGGGG + Intronic
1102925281 12:116821484-116821506 TGTCCTGGGAAGGTGGCCTGCGG - Intronic
1104356038 12:128087951-128087973 TGCTCTGGAAAGGGCTGCTGGGG + Intergenic
1104856322 12:131904023-131904045 TGCCCTGGGTAGGGGTGTTGGGG + Intronic
1105610916 13:21969380-21969402 GCCCCAGGCAAGGGGTCCAGGGG + Intergenic
1106618456 13:31352256-31352278 TGCACTGGTAAGGGGGTCTGCGG + Intergenic
1107143578 13:37032550-37032572 TACCCTGGCACTGGTTCCTGAGG - Intronic
1107723865 13:43277566-43277588 TGACCTGGCAAGGATCCCTGTGG + Intronic
1112488272 13:99839422-99839444 TGCCTTGGCCAGAGCTCCTGAGG + Intronic
1112543281 13:100338476-100338498 TGACCTTGCAAGGACTCCTGGGG + Intronic
1113706438 13:112436292-112436314 TGCTCTGCCAAGGTTTCCTGGGG - Intergenic
1113769957 13:112901479-112901501 TTCCTAGGGAAGGGGTCCTGCGG + Intronic
1113887205 13:113667225-113667247 GGCCCTGTCGAGGGTTCCTGGGG - Exonic
1114664121 14:24368449-24368471 TGGGCTGGGAAGGGGTCTTGGGG + Intronic
1119032125 14:71200924-71200946 TGCCCTGACAACTGGACCTGTGG + Intergenic
1119483994 14:74976687-74976709 TGCCCAGCCCAGGGGTACTGGGG + Intergenic
1121120221 14:91371768-91371790 TGCCCTGGCATAGGTGCCTGTGG - Intronic
1121515325 14:94545764-94545786 TTCCATGGCAACGGGTGCTGTGG + Intergenic
1121774920 14:96584252-96584274 TGCCCTTGCCAGGGGTCCCCAGG - Intergenic
1121996342 14:98606442-98606464 CTCCCTGGCAAGGGCTCCTCAGG - Intergenic
1122122273 14:99560937-99560959 TACCCTGGCAAGGCTCCCTGTGG - Intronic
1122319690 14:100846320-100846342 TGCCTTGCCCAGGGGGCCTGGGG + Intergenic
1122599079 14:102912404-102912426 TGCGCTGGCAAGGGACCCTCAGG - Intergenic
1122794394 14:104198723-104198745 TGACCTGGCAAAGGGTCCTTTGG - Intergenic
1124253181 15:28120937-28120959 TGCCATGGAATAGGGTCCTGTGG - Intronic
1125476928 15:40054071-40054093 TGTCCTGGCAAGAGGCCCAGGGG - Intergenic
1126702705 15:51382230-51382252 ACCCCTGACAAGGGGTACTGGGG - Intronic
1127311576 15:57756183-57756205 TGCCATTGCCAGGGGTTCTGGGG + Intronic
1128249128 15:66152530-66152552 AGGCCTTGCCAGGGGTCCTGTGG + Intronic
1128548557 15:68583438-68583460 TGCCCTGGCAAGGGGTCCTGGGG + Intronic
1129107302 15:73319004-73319026 TCCCCTGGCAAGCGGTGATGGGG + Intergenic
1129424350 15:75453582-75453604 TGCCCTGGCCTGGGGCCCTTAGG - Intronic
1130620225 15:85454102-85454124 TGCCATGGAAGTGGGTCCTGTGG + Intronic
1131116539 15:89799611-89799633 TGCTCTTGCAAGAGGTCCAGGGG - Intronic
1131249410 15:90820589-90820611 TGCTCAGGAAAGGGGTCCCGCGG - Intergenic
1132501156 16:285263-285285 TGCCTAGGCTGGGGGTCCTGTGG + Intronic
1133132341 16:3685048-3685070 TGCTGGGGCAAGGGGTCATGGGG - Intronic
1133231822 16:4370620-4370642 AGCCCTGGAAAGGGGCCCTGTGG + Intronic
1134442878 16:14309750-14309772 CGCCTTGGCAGGGGGCCCTGGGG + Intergenic
1135418954 16:22291517-22291539 TTGCCTGGGAAGGGGTCCAGGGG - Intergenic
1136617639 16:31408419-31408441 TGCCCTGGACTGGGTTCCTGTGG - Exonic
1137445130 16:48526956-48526978 GGCCCAGGCTAGGGATCCTGTGG - Intergenic
1137734722 16:50715454-50715476 TGCCCAGGCAGGGGGTACAGTGG + Intronic
1138391164 16:56670693-56670715 TGCTCTGTCCAGGGCTCCTGTGG + Intronic
1139327086 16:66160988-66161010 TGCCCGGGCAAGGGTTGATGGGG + Intergenic
1139370085 16:66461664-66461686 TGCCATGGCCAGGGGTCATGGGG + Intronic
1139971362 16:70777652-70777674 TGCCCTGACTGGAGGTCCTGTGG + Intronic
1141701209 16:85642935-85642957 TGCGCTGGAGAGTGGTCCTGTGG + Intronic
1142280538 16:89145539-89145561 TGCCCTGGCCAGGGAACATGGGG + Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1143178326 17:4969037-4969059 TTCCCTGCCTAGGGTTCCTGGGG - Intronic
1146633975 17:34490730-34490752 TGCCCAGGCATGAGGGCCTGAGG - Intergenic
1147167815 17:38602768-38602790 TGCTCTTGCAAAGGGGCCTGTGG - Intronic
1147353105 17:39867862-39867884 TCCCCTAGGAAGGGGACCTGAGG - Intergenic
1147792921 17:43024764-43024786 TGTCCTGGCAGGGGGTCTTGGGG - Intronic
1147896719 17:43756209-43756231 TGCCCAGGCCAGGGACCCTGCGG - Intronic
1147973118 17:44230586-44230608 TACCCTGGCACTGGTTCCTGTGG + Intergenic
1149305160 17:55340315-55340337 TGCCCTGGAAAGAGGCCCTTGGG + Intergenic
1151658274 17:75505781-75505803 TACCCTGCCCAGGGGGCCTGGGG - Intronic
1152300834 17:79494686-79494708 TGCCCAGGCAAGGAGGCCAGAGG + Intronic
1152463899 17:80455159-80455181 AGCCCTGGCCTGAGGTCCTGAGG + Intergenic
1152555123 17:81049217-81049239 TGTCCTGGCAGGGGGGCATGGGG + Intronic
1152618790 17:81350516-81350538 TGCCCAAGCAAGTGCTCCTGCGG - Intergenic
1152718083 17:81909413-81909435 TGCCCTGGCAAGGTGGCCCCAGG + Intronic
1154930393 18:20988711-20988733 TGCCCTGGATGGGGGTTCTGAGG - Intronic
1155151254 18:23124793-23124815 TGCCCTTGGCAGGGGGCCTGAGG - Intergenic
1155363017 18:25021016-25021038 TGCCCTGGCCAGGGGTATTGGGG - Intergenic
1156921661 18:42529733-42529755 AGCCCTGGCATGTTGTCCTGAGG - Intergenic
1157624574 18:49040347-49040369 TGACCTGGCCAAGGGTCTTGGGG + Intergenic
1158111375 18:53944087-53944109 TCCCATGGCAGGGGCTCCTGTGG + Intergenic
1158350883 18:56563536-56563558 TGCCATGGGAAGGGGGCCTGCGG + Intergenic
1160213957 18:76910082-76910104 TGCCCTCGCAGAGGGTCCTGTGG - Exonic
1160527015 18:79544158-79544180 TGTCTTGGGAAGGGCTCCTGGGG - Intergenic
1160716134 19:577676-577698 AGCCCTGGCTGGGAGTCCTGTGG + Intronic
1161108113 19:2454723-2454745 TGCCATGGGTTGGGGTCCTGGGG - Intronic
1163241088 19:16064342-16064364 GGCCCTGACCAGGGCTCCTGGGG + Intergenic
1163485247 19:17581519-17581541 TGGCCTGCCAAGGGGTCCAGAGG - Exonic
1163846671 19:19642095-19642117 TGTCCTGCCAAGGGGTGCTGGGG + Intronic
1164296087 19:23911273-23911295 TGCCATGGCAAAGGTTACTGAGG - Intergenic
1164721036 19:30431740-30431762 TGCCCCAGGGAGGGGTCCTGCGG + Intronic
1165049440 19:33132254-33132276 TGTCCCGGCAAGCTGTCCTGGGG + Exonic
1165403826 19:35618256-35618278 TGGCTGGGCCAGGGGTCCTGAGG - Intronic
1165823501 19:38692505-38692527 CGCCCTGGCAAGGGGGCCCGTGG - Intronic
1165853737 19:38867382-38867404 AGCCCTGGCCAGTTGTCCTGTGG - Intergenic
1166356208 19:42229072-42229094 GGACCTGGGAAGGGGTCATGGGG + Intergenic
1166766078 19:45252498-45252520 TGGCCTAGCAGGGGGTCCAGAGG - Intronic
1166966703 19:46533445-46533467 AGCTCTGGGGAGGGGTCCTGGGG + Intronic
1167723352 19:51194129-51194151 TGCCCTGGAAAGGAAGCCTGGGG - Intergenic
1168237128 19:55070618-55070640 TTCCCTGGCAATGGGAGCTGAGG - Intronic
927554013 2:24020079-24020101 TGTCCTGGTGAGGGGGCCTGGGG + Intronic
927554482 2:24022510-24022532 TGTCCTGGTGAGGGGGCCTGGGG + Exonic
929533180 2:42764785-42764807 TGCCATGGCACGGGGAGCTGGGG + Intergenic
933902726 2:86861427-86861449 TGGCCAGGCCATGGGTCCTGTGG - Intronic
937429234 2:121824664-121824686 TGCCCTGACACTAGGTCCTGGGG + Intergenic
937487347 2:122328705-122328727 TGCCAGGGCATGGGTTCCTGAGG + Intergenic
938291891 2:130154964-130154986 GGCCCCGGCAAAGGGTGCTGTGG - Intronic
938464659 2:131518000-131518022 GGCCCCGGCAAAGGGTGCTGTGG + Intergenic
940947768 2:159637288-159637310 TGCCCTGGGAGGGGCTCCAGAGG + Intergenic
942141935 2:172985605-172985627 TGACTTGGCAGGGTGTCCTGTGG + Intronic
946459557 2:219856943-219856965 TGCCCTGGCAAGGAGTAGGGGGG + Intergenic
946903642 2:224395782-224395804 TGCAATGGCAAGAGGTCATGTGG + Intronic
947933401 2:233983111-233983133 TGGCCAGGCAAGGGATCCTTAGG + Exonic
948427124 2:237895261-237895283 TGCTGTGCAAAGGGGTCCTGTGG + Intronic
948619240 2:239223629-239223651 GGCCTTGGTAAGGGGACCTGTGG + Intronic
948632329 2:239310105-239310127 TCCCCCAGCAGGGGGTCCTGGGG - Intronic
948890148 2:240903497-240903519 CGCCCTGGAAAGGCATCCTGGGG + Intergenic
1169275739 20:4232674-4232696 TGCCCTGCCCAGGGGTCCCCAGG + Intronic
1169874620 20:10283402-10283424 TGCGCTGTCAAGGACTCCTGAGG + Intronic
1170119985 20:12901132-12901154 TGCCCTGTGCAGGGGACCTGAGG + Intergenic
1171026962 20:21639553-21639575 TGCCATGGGAAGAGGCCCTGGGG + Intergenic
1171365064 20:24617784-24617806 AGCCCGGGAAGGGGGTCCTGGGG + Intronic
1174945453 20:54980305-54980327 GGCCATGGCAATGGGTCCTGTGG + Intergenic
1174945464 20:54980363-54980385 TTCCTTGGCAATAGGTCCTGTGG + Intergenic
1175184294 20:57169631-57169653 GGCCCTGGCAAGGGCACCCGTGG - Exonic
1175895048 20:62332464-62332486 TGCCCCGGCACAGGGTGCTGTGG + Exonic
1175896198 20:62336516-62336538 AGCCCTGACAAGGGGTGGTGAGG + Intronic
1177146416 21:17411816-17411838 TGCCCTGGCAAGGGCTCTTCTGG - Intergenic
1179573588 21:42292475-42292497 TGCCCTAGGCAGGGGTCCTGGGG - Intronic
1179616021 21:42583949-42583971 TGCCCTGGCCATGTGCCCTGTGG + Intergenic
1179841616 21:44079455-44079477 TGTCCTGGCATGGGGTCTGGAGG + Intronic
1179951952 21:44713193-44713215 GGAGCTGGCAGGGGGTCCTGGGG - Intergenic
1183126459 22:35786558-35786580 TCCCCTGGCAAAGGGTCACGAGG + Intronic
1183341709 22:37285109-37285131 TGCCCTGGAAAGGGGAAGTGAGG + Intronic
1183650107 22:39148874-39148896 TGACCTGGTATGGGGTCCTGTGG - Intronic
1184112109 22:42401532-42401554 GGCCGGGGCAAGGGGTCCCGTGG + Intronic
1184420693 22:44381328-44381350 TGCCCTGGCAACAGGAGCTGAGG + Intergenic
1184478569 22:44734769-44734791 TGCCCTGGAAAAAGGCCCTGTGG - Intronic
1185070542 22:48653453-48653475 TGCCCTGGCCAGGGCCACTGTGG + Intronic
1185077855 22:48692887-48692909 TGGCCTGGGAGGGGCTCCTGAGG - Intronic
950143022 3:10628173-10628195 AGCCCTGGCCATGGGCCCTGAGG - Intronic
950577770 3:13843042-13843064 TGCCATGGCTTGGTGTCCTGTGG + Intronic
950641939 3:14354061-14354083 TGCCCTGGAGAGGGGCCCTCTGG + Intergenic
951437031 3:22676699-22676721 GGGCCTGGCATGGGGTCCTCAGG + Intergenic
951840858 3:27032458-27032480 TGACCAGGGAAGGGATCCTGGGG + Intergenic
952629747 3:35452655-35452677 TGCCCGGGCAAAATGTCCTGTGG - Intergenic
953472265 3:43177505-43177527 AGGCCTGGCAAGGAGGCCTGTGG - Intergenic
953924337 3:46974409-46974431 TTCCCTGGCAATGGGCTCTGTGG + Intronic
961042796 3:123689173-123689195 TGCCCTGGCCAGGGTGGCTGGGG + Intronic
961165911 3:124763788-124763810 TGACCTGGGAAGGGATCCTAGGG - Intronic
961166509 3:124767169-124767191 GGCAATGGCAATGGGTCCTGGGG + Intronic
961433246 3:126898122-126898144 TGACCTTGCACTGGGTCCTGCGG - Intronic
962603620 3:137013788-137013810 TGTCCTGTCAAGGGGTTCGGTGG + Intergenic
962746245 3:138399098-138399120 GGCCCTGGTAAGGGGTGCTGAGG - Intronic
968425727 4:522066-522088 TGCCCTGGACAGGGGGCCTCAGG + Intronic
968830572 4:2931341-2931363 TGCCCTGGCAGGGGATCCGATGG - Intronic
969448900 4:7261807-7261829 TGCCTGGGGAAGGGGCCCTGTGG + Intronic
969835966 4:9841825-9841847 AGCCCTCTCAAAGGGTCCTGGGG - Intronic
972772595 4:42211481-42211503 TGGCCTGGCAGTGGGACCTGAGG - Intergenic
972788228 4:42346760-42346782 TCCGCAGGCAAGTGGTCCTGAGG - Intergenic
974438935 4:61892665-61892687 TCCCATGCCAAGAGGTCCTGTGG - Exonic
976456690 4:85256211-85256233 TACCCTGGCAAGAGATTCTGAGG + Intergenic
985606743 5:862003-862025 TGCCCTGGCATGCGGGCTTGGGG + Intronic
987232860 5:15912822-15912844 TGCCCTAGAAAGGGGCTCTGGGG + Intronic
988510317 5:31859052-31859074 AGACCTGCCAAGTGGTCCTGTGG + Intronic
988801889 5:34703704-34703726 AGGCCTTGCAAGGGGCCCTGAGG + Intronic
990040943 5:51378437-51378459 TGTCCTGGGAAGGAGTCCTCGGG - Intergenic
994732006 5:103503153-103503175 TGCCCTGGCAGGGATTCATGTGG - Intergenic
995263951 5:110137208-110137230 TTGCCTTGCAAGAGGTCCTGAGG - Intergenic
997677552 5:135724549-135724571 TGTCCTGTCCAGGGTTCCTGTGG - Intergenic
998307918 5:141096978-141097000 TGCCCTGGAAAGGGGCCCTCGGG - Exonic
998308554 5:141102831-141102853 TGCCCTGGAAAGGGGCCCTCGGG - Exonic
998310461 5:141124177-141124199 TGCCCTGGAAAGGGGCCCTCGGG - Exonic
998311618 5:141137613-141137635 TGCCCTGGAAAGGGGCCCTCGGG - Exonic
998312900 5:141152433-141152455 TGCCCTGGAAAGGGACCCTCGGG - Exonic
998313593 5:141158182-141158204 TGCCCTGGAAAGGGGCCCTCGGG - Intergenic
998315662 5:141180219-141180241 TGCCCTGGAAAGGGGCCCTCAGG - Exonic
998316204 5:141184741-141184763 CGCCCTGGAAAGGGGCCCTCAGG - Exonic
998318066 5:141201956-141201978 TGCCCTGGAAAGGGGCCCTTAGG - Exonic
998319027 5:141211089-141211111 TGTCCTGGAAAGGGGCCCTCAGG - Exonic
998319593 5:141216305-141216327 TGCCCTGGAAGGGGGCCCTCGGG - Exonic
998320572 5:141225687-141225709 TGCCCTGGAAAGGGACCCTCGGG - Exonic
998322804 5:141247760-141247782 TGCCCTGGAAAGGGGCCCTCGGG - Exonic
998994115 5:147851854-147851876 TGCCCTTGCAAGTGTCCCTGTGG - Intergenic
999434247 5:151550774-151550796 ACCCCTGGCACGGTGTCCTGGGG + Exonic
1002430321 5:179199539-179199561 TGCCCTGGCCAGGGCGTCTGGGG - Intronic
1002602430 5:180361706-180361728 AGCCCTGGCCAGGAGCCCTGGGG + Intergenic
1003124970 6:3348845-3348867 TGCCCTGGCTCTGGGTCATGGGG - Intronic
1003172869 6:3733827-3733849 TGCCATGGGAAGGGGTCAGGTGG - Intronic
1007262699 6:40575021-40575043 AGCCATGGCAATGGGTCCTTAGG + Intronic
1012247111 6:96938346-96938368 TTCCCTGCCAGAGGGTCCTGGGG + Intronic
1013465562 6:110414507-110414529 AGCCCGGGCCAGGTGTCCTGAGG + Intronic
1018540694 6:164876319-164876341 TGACATGTCTAGGGGTCCTGTGG + Intergenic
1019446001 7:1071690-1071712 TTCCCTGGCAATGCGTCCTGTGG - Intronic
1020134559 7:5579730-5579752 TGCCCTGGCAGGGGGACAGGAGG + Intergenic
1022838854 7:34143452-34143474 TCCTCTGGCAAGGGGGCATGTGG - Intronic
1023863572 7:44228645-44228667 TGCCCTGGCGGGGCTTCCTGTGG - Intronic
1026846409 7:73701190-73701212 TGCCCTGGCCATAGCTCCTGAGG + Intronic
1029125951 7:98295300-98295322 TGCCCTGCCCAGGGGATCTGGGG - Intronic
1034426761 7:151018121-151018143 TGCCCTGGCGAGGGTCGCTGGGG - Intronic
1034558555 7:151865159-151865181 TGCCATGGCCAAGGGGCCTGAGG + Intronic
1035022109 7:155806060-155806082 TGCCCCGAGATGGGGTCCTGTGG - Intronic
1035029485 7:155848246-155848268 GGCCCTGGCAGGAGGCCCTGAGG + Intergenic
1035083812 7:156239209-156239231 TGCCCTGACATGGCTTCCTGGGG - Intergenic
1035260561 7:157659194-157659216 TGCTGTGGGAAGGGGCCCTGCGG + Intronic
1035281238 7:157779701-157779723 TGTCCTGATGAGGGGTCCTGAGG + Intronic
1035721613 8:1797207-1797229 TGCCCTGGCAGGGGTGACTGTGG - Intergenic
1037820640 8:22133247-22133269 TGCCCAGGTAAGGGGCTCTGGGG - Intronic
1038422360 8:27441566-27441588 TGCCCAGGCCAGGGGCACTGAGG + Intronic
1040277779 8:46022721-46022743 AGCCCTTGCAAAGGGCCCTGAGG - Intergenic
1040554230 8:48464968-48464990 TGGGATGGCAGGGGGTCCTGGGG + Intergenic
1041196285 8:55404803-55404825 TGCCTTGGCAAGAGTTACTGTGG - Intronic
1041325483 8:56659080-56659102 TGCCCTGGTCATGGGTGCTGAGG + Intergenic
1041471939 8:58220303-58220325 TGCCCTGGCTGGGGGTGCAGCGG - Intergenic
1041694615 8:60722236-60722258 TGCCCTGTCAAGGATGCCTGTGG + Intronic
1043404579 8:79917309-79917331 GGCCCTGGGAAGGGGTGGTGTGG + Intergenic
1043834447 8:85031305-85031327 TGCCATGGCAAGGGGAGCTCAGG + Intergenic
1047763521 8:127971617-127971639 TGGCCTGGCATGGGTTCCAGAGG - Intergenic
1048573651 8:135674574-135674596 TGCCCATGCAAGGGGTGATGGGG + Intergenic
1048970748 8:139643766-139643788 GGCTTTGGCCAGGGGTCCTGGGG - Intronic
1048979382 8:139694891-139694913 TGCCCTTGCCTGGGGTCTTGGGG - Intronic
1049176792 8:141197689-141197711 TTCCATGCCACGGGGTCCTGAGG - Intergenic
1053140933 9:35682287-35682309 GTCCCTGCCAAGGGGCCCTGAGG - Intronic
1057833772 9:98427814-98427836 AGCCCTGTGGAGGGGTCCTGAGG + Intronic
1059419680 9:114183208-114183230 AGCCCTGGAAAGGGGCCCAGAGG - Intronic
1060523462 9:124307644-124307666 TGCCCTGGCAGAGGAGCCTGAGG + Intronic
1060881734 9:127122499-127122521 AGGGCTGGCCAGGGGTCCTGCGG + Exonic
1061929902 9:133827098-133827120 TGCTCTGGCCTGGAGTCCTGGGG - Intronic
1062342547 9:136100228-136100250 GGCCCTGACAAGGGGCCCTGTGG - Intergenic
1062540443 9:137039622-137039644 CTCCCTGGCAAGGGGTCCCAGGG + Exonic
1203791829 EBV:155742-155764 AGACCCGGCAGGGGGTCCTGCGG + Intergenic
1187655173 X:21463754-21463776 GGGCCTGGAAAGGGGGCCTGAGG + Intronic
1187773293 X:22726990-22727012 TTCCTTTGCAAGGGGTTCTGAGG + Intergenic
1189098569 X:38165123-38165145 TGGCCTTGCAAGGTGTCCTGTGG + Intronic
1190296358 X:49030042-49030064 TGCCCTGCCCAGGTATCCTGGGG - Exonic
1191714365 X:64184194-64184216 TGGCCTGGGAAGGGGCCCTAGGG + Intergenic
1197870308 X:131057975-131057997 TGCCCGATCAAGGGCTCCTGGGG + Intergenic
1200183146 X:154163628-154163650 TGCCAAAGCAAGGGGCCCTGGGG + Intergenic
1200188800 X:154200742-154200764 TGCCAAAGCAAGGGGCCCTGGGG + Intergenic
1200194450 X:154237883-154237905 TGCCAAAGCAAGGGGCCCTGGGG + Intergenic
1200200205 X:154275686-154275708 TGCCAAAGCAAGGGGCCCTGGGG + Intronic
1202335161 Y:23801165-23801187 TCCCCTGGAAAGGGGTGCTGAGG + Intergenic
1202535606 Y:25868894-25868916 TCCCCTGGAAAGGGGTGCTGAGG - Intergenic