ID: 1128551284

View in Genome Browser
Species Human (GRCh38)
Location 15:68599609-68599631
Sequence CACGCTGCCCAGACAGATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 239}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128551275_1128551284 0 Left 1128551275 15:68599586-68599608 CCTTTCTTCAATTGCCCCACCCC 0: 1
1: 1
2: 2
3: 31
4: 289
Right 1128551284 15:68599609-68599631 CACGCTGCCCAGACAGATCTGGG 0: 1
1: 0
2: 2
3: 14
4: 239
1128551274_1128551284 29 Left 1128551274 15:68599557-68599579 CCTGAGACGGATATAGGGAGCTT 0: 1
1: 0
2: 1
3: 12
4: 83
Right 1128551284 15:68599609-68599631 CACGCTGCCCAGACAGATCTGGG 0: 1
1: 0
2: 2
3: 14
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128551284 Original CRISPR CACGCTGCCCAGACAGATCT GGG Intronic
902594055 1:17495930-17495952 CATGTTGCCCAGACTGGTCTCGG + Intergenic
904258262 1:29271234-29271256 CACGCTGACAAAACAGAACTTGG - Intronic
906560579 1:46753944-46753966 CACCCTGCCCAGGCAGATCTGGG - Intergenic
907050172 1:51324964-51324986 CACCATGCCCAGACAGATGTGGG - Intronic
907377634 1:54056838-54056860 CAAGCTGCCCAGGCTGATCTCGG - Intronic
911202558 1:95060426-95060448 CACTGTGCCCAGCCAGATTTTGG - Intronic
911337253 1:96595824-96595846 CACTCTGCCCAGCCAAGTCTAGG - Intergenic
912125143 1:106527080-106527102 CCCACTGCCCAGAAAAATCTGGG - Intergenic
915501069 1:156318111-156318133 CACACTGCCAGGACAGATGTAGG - Intronic
915893428 1:159792269-159792291 CACGGTGCCAGGGCAGATCTGGG - Intergenic
917834232 1:178928186-178928208 CATGTTGTCCAGACTGATCTTGG + Intergenic
917917829 1:179722109-179722131 CACATTGCCCAGACCGGTCTTGG - Intergenic
918500456 1:185189188-185189210 CATGTTGCCCAGGCTGATCTTGG + Intronic
919348506 1:196418185-196418207 CACCGTGCCCAGCCAAATCTGGG - Intronic
919513809 1:198496863-198496885 CATGTTGCCCAGGCTGATCTTGG + Intergenic
922679144 1:227576455-227576477 CACCCTCCCCAGACTGAACTAGG - Intronic
922808752 1:228404217-228404239 CACACAACCCAGAGAGATCTGGG + Intronic
923293656 1:232572184-232572206 CATGCTGCCCGGACACAGCTGGG - Intergenic
923537609 1:234865030-234865052 CACGCTGCTCAGAGAGACGTGGG - Intergenic
1063169265 10:3492039-3492061 AACACTGTCCAGACAGATTTGGG - Intergenic
1063881401 10:10536304-10536326 CACCATGCCCAGACAGCTTTTGG + Intergenic
1065098209 10:22303794-22303816 CATGTTGCCCAGGCTGATCTTGG - Intergenic
1065136132 10:22672249-22672271 CTGGCTGCCCTGACAGCTCTGGG + Intronic
1066012369 10:31206756-31206778 TATGTTGCCCAGACTGATCTTGG + Intergenic
1068820123 10:61365805-61365827 CACTGTGCCCAGACAGTCCTAGG + Intergenic
1069644631 10:69984726-69984748 CATGCTGCCCAGGCTGGTCTTGG - Intergenic
1071524548 10:86350597-86350619 GATGATGCCCAGACAGCTCTGGG + Intronic
1072619957 10:97073360-97073382 CATTCTGCCCAGACACATCCTGG - Intronic
1073599349 10:104831602-104831624 CACGTTGCTTGGACAGATCTAGG - Intronic
1075485565 10:122819411-122819433 CAGAATGCCCAGACAGATATTGG - Intergenic
1075761764 10:124863026-124863048 CATGTTGCCCAGGCAGGTCTCGG + Intergenic
1076292337 10:129355961-129355983 CACCATGCCCAGCCAGATGTGGG + Intergenic
1076350644 10:129812817-129812839 TACTCTGCCCAGAAAGCTCTGGG - Intergenic
1076819797 10:132932541-132932563 CACGCTCCCCATACAGAGCCTGG + Intronic
1076819820 10:132932627-132932649 CACGCTCCCCACACAGAGCCTGG + Intronic
1077056736 11:597606-597628 CCAGCTGCCCAGAGTGATCTCGG + Intronic
1080645840 11:34186865-34186887 CAAGCTGCCCACACCGCTCTGGG + Intronic
1083801006 11:65046221-65046243 CAGGCAGCCCAGCAAGATCTTGG - Exonic
1088312576 11:108475755-108475777 CACCCTGCCCAGACATAAATTGG + Intronic
1090383411 11:126342754-126342776 CTCCCTGCCCCGACAGCTCTGGG + Intronic
1092034236 12:5317066-5317088 AAGGCTGTCCAGACAGCTCTGGG - Intergenic
1093321393 12:17719144-17719166 CACGCTGCCCTGCCAGAGGTGGG + Intergenic
1095053404 12:37574260-37574282 CATGTTGCCCAGGTAGATCTTGG + Intergenic
1098496050 12:71136739-71136761 CAGACTGGTCAGACAGATCTGGG + Intronic
1100457422 12:94765836-94765858 CACCATGCCCAGCCAGATTTGGG + Intergenic
1102431673 12:112888987-112889009 CAGGCTGCCCAGAGAGACCAGGG - Intronic
1103321171 12:120093595-120093617 CCCGCTGCCCCCACAGGTCTAGG - Exonic
1103562645 12:121800423-121800445 CCCGCTGCCCACCCAGCTCTGGG - Intronic
1103843222 12:123882331-123882353 CAGCCTGCACACACAGATCTGGG + Intronic
1104156369 12:126136720-126136742 CACGCTTGCCAGACAGAGCTTGG - Intergenic
1104396610 12:128439290-128439312 CATGCTGCCCAGACAACGCTAGG + Intronic
1105244247 13:18634253-18634275 CACCCTCCCAAGACAGAACTAGG + Intergenic
1105433397 13:20357781-20357803 CACGCTGCCCAGCCAAAACCAGG + Intergenic
1107879468 13:44820545-44820567 GATGCTGCCCAGTAAGATCTGGG + Intergenic
1108072444 13:46642040-46642062 CACGCTGCAGAGCCAGACCTAGG + Intronic
1109145079 13:58769421-58769443 CATGCTGCCCAGTCTGGTCTTGG + Intergenic
1110232246 13:73179142-73179164 TACGTTGCCCAGACTGGTCTTGG + Intergenic
1114291149 14:21289438-21289460 TATGTTGCCCAGACTGATCTTGG - Intronic
1119468266 14:74876604-74876626 CACCCATCCCTGACAGATCTGGG + Intergenic
1119473912 14:74916162-74916184 AGCTGTGCCCAGACAGATCTGGG - Intronic
1120100636 14:80441252-80441274 CACCATGCCCAGCCACATCTGGG - Intergenic
1120472597 14:84945106-84945128 CACCGTGCCCAGACGGTTCTAGG + Intergenic
1121119530 14:91367637-91367659 CAAACTGCCCAGACAAGTCTGGG + Intronic
1121578658 14:95009893-95009915 CACTGTGCCCAGCCAGTTCTAGG - Intergenic
1122937405 14:104966549-104966571 CAACCTGCACAGACAGAACTTGG + Intronic
1123664411 15:22597257-22597279 CATGCTGCCCAGGCTGATATCGG - Intergenic
1124318246 15:28691694-28691716 CATGCTGCCCAGGCTGATATCGG - Intergenic
1127066028 15:55239741-55239763 CACGCTGACCAGGCTGGTCTGGG + Intronic
1127467468 15:59258143-59258165 CACGTTGGCCAGACTGGTCTCGG - Intronic
1127803678 15:62499245-62499267 CATGTTGCCCAGGCTGATCTTGG - Intronic
1128551284 15:68599609-68599631 CACGCTGCCCAGACAGATCTGGG + Intronic
1131508951 15:93038467-93038489 CAGGCTGACCAGCCAGAACTGGG - Intronic
1132404992 15:101536601-101536623 CACGCTGCTCCCACAGCTCTGGG - Intergenic
1133041749 16:3064719-3064741 CACGCTGCCCACATTGACCTTGG + Intergenic
1133254675 16:4509441-4509463 CACACTGGCCAGAGAGACCTTGG + Exonic
1134167682 16:11943413-11943435 CACCATGCCCAGCCAAATCTAGG - Intronic
1134493018 16:14710314-14710336 CACCATGCCCAGCCAAATCTAGG + Intronic
1134498399 16:14749438-14749460 CACCATGCCCAGCCAAATCTAGG + Intronic
1134524948 16:14936061-14936083 CACCATGCCCAGCCAAATCTAGG + Intronic
1134547946 16:15124858-15124880 CACCATGCCCAGCCAAATCTAGG - Intronic
1134582178 16:15379657-15379679 CACCATGCCCAGCCAAATCTAGG - Intronic
1134712538 16:16334548-16334570 CACCATGCCCAGCCAAATCTAGG + Intergenic
1134720405 16:16377859-16377881 CACCATGCCCAGCCAAATCTAGG + Intergenic
1134896288 16:17889780-17889802 CAAGATGCACAGACAGAGCTTGG - Intergenic
1134947022 16:18334026-18334048 CACCATGCCCAGCCAAATCTAGG - Intronic
1134954289 16:18374145-18374167 CACCATGCCCAGCCAAATCTAGG - Intergenic
1135313111 16:21421061-21421083 CACCATGCCCAGCCAAATCTAGG - Intronic
1135366035 16:21853341-21853363 CACCATGCCCAGCCAAATCTAGG - Intronic
1135445780 16:22517825-22517847 CACCATGCCCAGCCAAATCTAGG + Intronic
1136152264 16:28358793-28358815 CACCATGCCCAGCCAAATCTAGG - Intronic
1136194479 16:28642390-28642412 CACCATGCCCAGCCAAATCTAGG + Intronic
1136210816 16:28756489-28756511 CACCATGCCCAGCCAAATCTAGG + Intronic
1136255536 16:29036449-29036471 CACCATGCCCAGCCAAATCTAGG + Intergenic
1136309779 16:29399788-29399810 CACCATGCCCAGCCAAATCTAGG - Intronic
1136323222 16:29501567-29501589 CACCATGCCCAGCCAAATCTAGG - Intronic
1136437907 16:30241537-30241559 CACCATGCCCAGCCAAATCTAGG - Intronic
1138676992 16:58658637-58658659 CATGTTGCCCAGGCTGATCTTGG - Intergenic
1139120491 16:64010135-64010157 CATGTTGGCCAGACTGATCTCGG + Intergenic
1139389484 16:66597512-66597534 CAAACTGCCCAGAGAGACCTTGG + Intergenic
1139857463 16:69992169-69992191 CACCATGCCCAGCCAAATCTAGG - Intergenic
1140077080 16:71710048-71710070 CATGTTGCCCAGGCTGATCTAGG + Intronic
1140365211 16:74375753-74375775 CACCATGCCCAGCCAAATCTAGG + Intergenic
1141066183 16:80915910-80915932 CTCCCTGCCAAGACAGATTTGGG + Intergenic
1141726276 16:85791027-85791049 CATGTTGCCCAGGCTGATCTTGG + Intronic
1142998643 17:3776709-3776731 CACCATGCCCAGACAGTTTTTGG + Intronic
1143228598 17:5330819-5330841 TACGCTGCCCAGGCTGGTCTTGG - Intronic
1143268355 17:5657570-5657592 CACCCTGCCCAGACAGGGCCTGG - Intergenic
1144660342 17:17063969-17063991 CACCCTCCCCAGGCAAATCTGGG - Intronic
1144737445 17:17563090-17563112 CCTGCTGCTGAGACAGATCTTGG - Intronic
1145219887 17:21079682-21079704 CACACTGACCAGACAGTTATAGG + Intergenic
1146398860 17:32488141-32488163 CACGCTGCGCAGCCAGAGCACGG - Exonic
1147442578 17:40456454-40456476 CACGCTGCCCATCCAGAGCTGGG - Exonic
1147752169 17:42743068-42743090 CATGTTGCCCAGGCAGCTCTCGG + Intronic
1149497511 17:57128976-57128998 CATGTTGCCCAGACTGGTCTAGG + Intergenic
1149858865 17:60109893-60109915 CATGCTACACAGACAGATCAGGG + Intergenic
1150144824 17:62759670-62759692 CACGCTGGCCAGGCTGGTCTTGG + Intronic
1151638558 17:75371106-75371128 CATGTTGCCCAGACTGGTCTCGG - Intronic
1152801188 17:82331345-82331367 CCTGCTGCCCAGACAGAGCTGGG - Intronic
1153636274 18:7116707-7116729 CACGCTGCGAAGACAGCTCTAGG + Intronic
1154118910 18:11635416-11635438 CACCATGCCCAGCCAAATCTAGG - Intergenic
1154444694 18:14425649-14425671 CACCCTCCCAAGACAGAACTAGG - Intergenic
1154971195 18:21411492-21411514 CACGGTGCCCAGCCAGATGTTGG + Intronic
1160523602 18:79522753-79522775 CACCCTGCCCAGCCAGCTCCTGG - Intronic
1160793850 19:934894-934916 CACGGTGCCCAGCCAGTCCTGGG + Intronic
1161055506 19:2188871-2188893 CACGCGGCCCAGCCAGGCCTGGG - Intronic
1162252158 19:9454764-9454786 CACACTGACCAGACAGTTATAGG - Intergenic
1162486883 19:10966387-10966409 CATGCTGCCCAGGCTGGTCTTGG - Intronic
1163010554 19:14422919-14422941 CACCATGCCCAGACCCATCTAGG - Intergenic
1163504002 19:17693740-17693762 CATGTTGCCCAGGCTGATCTGGG + Intergenic
1164619666 19:29687151-29687173 CAGGCTGCCCAAACACATTTGGG + Intergenic
1164964675 19:32471963-32471985 CACGGTGCCCATACACAGCTGGG - Intronic
1165699904 19:37929613-37929635 CACTCTGCCCAGAAACACCTGGG + Intronic
1166217780 19:41347222-41347244 CATGTTGCCCAGACTGGTCTCGG + Intronic
1166298550 19:41901652-41901674 CATGTTGCCCAGGCTGATCTTGG + Intronic
1166570718 19:43795197-43795219 CACCATGCCCAGCCAGATTTTGG - Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1167573804 19:50307816-50307838 GACTCTGTCCAGACAGACCTGGG - Intronic
1167863742 19:52307109-52307131 CACACTGACCAGACAGTTATAGG + Intronic
1168636949 19:58003748-58003770 CATGTTGCCCAGACTGGTCTCGG - Intronic
925363743 2:3296826-3296848 CACACTGCCCATCCAGCTCTGGG + Intronic
926059747 2:9797784-9797806 CATGCTGGCCAGACAGTGCTGGG - Intergenic
926128967 2:10288775-10288797 AACGCTGCCAAGACAGATCTAGG - Intergenic
927718398 2:25367479-25367501 AACGATGCCCACACAGAGCTGGG + Intergenic
928089079 2:28363247-28363269 CACGCTCGCCTGAAAGATCTGGG + Intergenic
928437097 2:31261753-31261775 CAGGCTGCTCAGCCAGCTCTCGG - Intronic
928598939 2:32884900-32884922 CACATTGCCCAGGCTGATCTTGG + Intergenic
931722388 2:65076783-65076805 CACCGTGCCCAGCCAGAACTTGG - Intronic
931862755 2:66373560-66373582 CACTGTGCCCAGCCAGAACTTGG - Intergenic
932450486 2:71807564-71807586 CATGCTGGCCATAAAGATCTGGG - Intergenic
933307204 2:80616552-80616574 CATTCTGACCAGACAGATGTAGG - Intronic
933677705 2:85071875-85071897 CATGTTGCCCAGGCTGATCTTGG + Intergenic
934968664 2:98745070-98745092 CCCGCTTCCCTGGCAGATCTAGG - Intergenic
936007693 2:108905595-108905617 CCCGCTGCCCGGCCAGATCAAGG + Intronic
936332247 2:111557726-111557748 CACACTGGACACACAGATCTTGG - Intergenic
937458082 2:122061296-122061318 CATGCTTCCCAGACTGAGCTGGG - Intergenic
939929510 2:148215809-148215831 CACCATGCCCAGCCAGACCTTGG + Intronic
941740784 2:169033025-169033047 CATGCTGGCCAGACACATCTGGG + Intergenic
944065586 2:195616241-195616263 CACCGTGCCCAGCCAGATCTAGG + Intronic
946212847 2:218161459-218161481 CACGTTGCCCAGGCTGGTCTTGG - Intergenic
948880138 2:240852450-240852472 CATTCTCCCCAGGCAGATCTTGG + Intergenic
948951867 2:241258050-241258072 CATGTTGCCCAGGCTGATCTTGG - Intronic
1171993847 20:31717320-31717342 CATGCAGCCCAAACAAATCTGGG + Intronic
1172388468 20:34550025-34550047 CAGGCGGGCCAGACAGACCTGGG - Exonic
1172490787 20:35335966-35335988 CGTGCTGCCCACACTGATCTTGG - Intronic
1172884132 20:38220009-38220031 GAAGCTGGCCGGACAGATCTGGG + Intronic
1172981950 20:38950107-38950129 CACCGTGCCCAGCCAGATCCTGG + Intronic
1173782998 20:45771981-45772003 AAAGCTGCCCAGAAAGACCTGGG + Intronic
1174269777 20:49359448-49359470 CACGTTGCCCAGGCTGGTCTTGG + Intergenic
1176424576 21:6540252-6540274 CACCTTGCCCAGCCAGACCTTGG - Intergenic
1176451292 21:6864214-6864236 CACCCTCCCAAGACAGAACTAGG + Intergenic
1176829461 21:13729265-13729287 CACCCTCCCAAGACAGAACTAGG + Intergenic
1178768273 21:35476134-35476156 AAGACTGCCCAGACAGATCATGG - Intronic
1179700069 21:43148567-43148589 CACCTTGCCCAGCCAGACCTTGG - Intergenic
1180743950 22:18074190-18074212 CACTGTGCCCAGCCAGATGTGGG + Intergenic
1181836491 22:25614333-25614355 CATGTTGCCCAGGCTGATCTTGG + Intronic
1182286282 22:29249951-29249973 CACCTTGCCCAGCCAGATCTTGG - Intronic
1183688398 22:39374967-39374989 CACGCCTCCCAGCCAGACCTTGG + Intronic
952830718 3:37562470-37562492 CCCGCTGCCCCGAAAGATCAGGG + Intronic
952956775 3:38562520-38562542 CAGGCTGACCAGAGAGACCTGGG + Exonic
952999109 3:38915185-38915207 CACCCTGCCAAGACTGAACTGGG - Intronic
953387695 3:42515839-42515861 CACACTGGGCAGACACATCTAGG - Intronic
953732474 3:45462161-45462183 CAGGCTGCCAAGACTGAACTGGG + Intronic
954164312 3:48744059-48744081 TACGTTGCCCAGGCAGGTCTCGG + Intergenic
954424624 3:50436859-50436881 GAGACTGCCCAGACCGATCTGGG - Intronic
955249738 3:57267801-57267823 CACTGTGCCCAGCCACATCTTGG - Intronic
955422084 3:58748836-58748858 CACCCTGGTCAGACAGGTCTGGG + Intronic
956676591 3:71739492-71739514 CATGTTGCCCAGACTGGTCTGGG - Intronic
956822075 3:72963108-72963130 CACGTTGCCCAGGCTGGTCTTGG - Intronic
957219479 3:77363663-77363685 CAGGCTGTCCAGACACTTCTTGG + Intronic
959127495 3:102307874-102307896 CCTGCTGCCTAGAGAGATCTTGG + Intronic
961503319 3:127352786-127352808 CTCACTGCCAAGACAGCTCTCGG + Intergenic
961796002 3:129409246-129409268 CATGTTGCCCAGGCTGATCTCGG - Intronic
966757457 3:183384762-183384784 CCTGCTGCCCAGACAGAACCAGG - Intronic
966901677 3:184491409-184491431 CCCGCCGCCCTGACAGAGCTTGG - Intronic
967113344 3:186315153-186315175 CTCTCTGCCCAGACAGTTCCAGG + Intronic
968432562 4:567368-567390 CATGGTGCCCAGGCAGGTCTTGG + Intergenic
968510290 4:992560-992582 TCCCCTGCCCAGACAGTTCTGGG + Intronic
969648750 4:8450167-8450189 CATGTTGCCCAGACTGGTCTTGG + Intronic
969895709 4:10302594-10302616 CACACTGACCAGACAGTTATAGG + Intergenic
970100514 4:12515772-12515794 CACCCTGGCCATGCAGATCTGGG + Intergenic
971395114 4:26220069-26220091 CACCCTGCCCAGCCAGAGCCAGG + Intronic
974186417 4:58453383-58453405 CATGTTGCCCAGACAGGTCTTGG + Intergenic
982247430 4:153367312-153367334 CACTCCTCCCACACAGATCTAGG + Intronic
985957736 5:3277270-3277292 CACACTGCTCAGACAGACATGGG + Intergenic
986024321 5:3836024-3836046 CACGCTGCCCAGACTGGGTTGGG + Intergenic
989037546 5:37191467-37191489 CACGTTGCCCAGGCTGATCTTGG - Intronic
990415474 5:55581862-55581884 CATGTTGCCCAGACTGATCCTGG - Intergenic
995379426 5:111515463-111515485 CATGTTGCCCAGACTGGTCTGGG - Intergenic
995417140 5:111924395-111924417 CAGTCTGGCCAGAGAGATCTTGG + Intronic
998381673 5:141730251-141730273 CACGCAGACAAGAAAGATCTAGG - Intergenic
999699896 5:154218705-154218727 CAAGCAGCCCAGACAGAATTGGG + Intronic
1001395049 5:171412736-171412758 CATGTTGCCCAGACTGGTCTTGG + Intergenic
1001770479 5:174292409-174292431 CCCCCTCCCCAGACAAATCTAGG + Intergenic
1002162952 5:177327478-177327500 CATGCTGCCCAGGTTGATCTTGG - Intergenic
1003190521 6:3870593-3870615 CACGTTGCCCAGGCTGATCTTGG - Intergenic
1003637417 6:7845403-7845425 CACCCTGCACAGACATAGCTGGG - Intronic
1004313925 6:14570182-14570204 CACGCTGGCCAGGCAGAATTGGG - Intergenic
1005678364 6:28179968-28179990 CATGTTGCCCAGACTGGTCTCGG + Intergenic
1006112390 6:31755782-31755804 CACGATGCCCAGTCAGATGATGG + Intronic
1006590951 6:35157234-35157256 CACCGTGCCCAGCCAGTTCTGGG + Intergenic
1007125441 6:39422289-39422311 CAGGCCCCCCAGACACATCTGGG - Intronic
1010736944 6:79453674-79453696 CACTCTGCCCACACAGCCCTTGG - Intergenic
1012584286 6:100903827-100903849 CACTGTGTCCAGACAGATATAGG + Intergenic
1016919603 6:149278875-149278897 CGTGTTGCCCAGACAGGTCTCGG - Intronic
1019785185 7:2972278-2972300 CACCATGCCCTGCCAGATCTGGG + Intronic
1021712789 7:23432839-23432861 CACGTTGCCCAGACTGGTCCTGG + Intronic
1026061393 7:67029900-67029922 CATGTTGCCCAGGCCGATCTAGG + Intronic
1026716955 7:72797513-72797535 CATGTTGCCCAGGCTGATCTAGG - Intronic
1029163714 7:98571200-98571222 AACTCTCCCCAGACAGAGCTGGG - Intergenic
1029612161 7:101632366-101632388 GACGCTGCCCACACAGATTAAGG + Intergenic
1030628574 7:111870608-111870630 CACTGTGCCCAGCCAGTTCTTGG + Intronic
1031868182 7:127062724-127062746 CACCCTCCCAAGACTGATCTAGG - Intronic
1034192878 7:149224798-149224820 CATTCAGACCAGACAGATCTGGG - Exonic
1039384665 8:37123788-37123810 CATGTTGCCCAGGCTGATCTTGG - Intergenic
1047484524 8:125316987-125317009 CATGTTGCCCAGACTGGTCTTGG + Intronic
1048865007 8:138753970-138753992 GAGGCTGCACAGTCAGATCTAGG + Intronic
1049263622 8:141653267-141653289 CCCGCAGCCCAGGCAGCTCTGGG + Intergenic
1050668162 9:7965272-7965294 GAGGCTGCCCAGCCAGATCCTGG - Intergenic
1050786679 9:9412428-9412450 CATGCAGCCCATACAGGTCTGGG + Intronic
1050790168 9:9458737-9458759 CATGCTGCCCAGGCAGGTCTAGG - Intronic
1053166584 9:35848199-35848221 CATGCTGCAGAGAGAGATCTTGG + Intronic
1055988436 9:82078488-82078510 CACGTTGCCCAGGCTGGTCTAGG - Intergenic
1057025952 9:91733868-91733890 CCTTCTCCCCAGACAGATCTGGG - Intronic
1057666085 9:97046479-97046501 CAGGCTGCCCAGGCAGGACTGGG + Intergenic
1058716320 9:107725403-107725425 CACGGTGCCGGGAAAGATCTAGG + Intergenic
1059130017 9:111737376-111737398 CACCGTGCCCAGCCAGATTTGGG - Intronic
1060258498 9:122053451-122053473 CACACAGCCCACACAGATCACGG + Intronic
1203517889 Un_GL000213v1:20303-20325 CACCCTCCCAAGACAGAACTAGG - Intergenic
1187944298 X:24411510-24411532 CACGCTACCCAGCTAGATTTTGG + Intergenic
1189818933 X:44851097-44851119 CACTGTGCCCAGCCAGATATGGG + Intergenic
1191857743 X:65640905-65640927 CATGTTGCCCAGGCTGATCTGGG - Intronic
1194587512 X:95754099-95754121 CACCCTCCCCAGACTGAACTAGG - Intergenic
1194677940 X:96815869-96815891 CACGTTGCCCAGGCTGGTCTTGG + Intronic
1196277812 X:113789077-113789099 CATGGTGCCCAGATTGATCTAGG - Intergenic
1196473449 X:116055177-116055199 CATGCTCCCAAGACTGATCTAGG - Intergenic
1197785302 X:130191996-130192018 CACTCTGGTCAGGCAGATCTTGG + Intergenic