ID: 1128553154

View in Genome Browser
Species Human (GRCh38)
Location 15:68611351-68611373
Sequence CAAGGTACCACCCTTTGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 55}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128553154 Original CRISPR CAAGGTACCACCCTTTGCAT TGG Intronic
903480005 1:23646046-23646068 CAAGGTACCACATTCTGCAGAGG + Intergenic
904133925 1:28296401-28296423 AAAGGGACCACCCTATGCATTGG - Intergenic
905271020 1:36787481-36787503 CACGGTACCACCCAGGGCATTGG + Intergenic
905630672 1:39516467-39516489 CAGGGTACCACCTGCTGCATGGG - Intronic
922001198 1:221480317-221480339 CAAAGCACCAACATTTGCATAGG + Intergenic
1076469312 10:130707647-130707669 GATGGTGCCACCCTTTCCATTGG - Intergenic
1077876372 11:6311404-6311426 CAGGGTAATACTCTTTGCATAGG - Intergenic
1085220182 11:74867081-74867103 GAAGGTGCCATCCTTTGGATGGG - Intronic
1090357943 11:126153022-126153044 CAGGGTCCCAGTCTTTGCATAGG + Intergenic
1090563002 11:127953390-127953412 CAAGGGAACACTCTTTGCAATGG - Intergenic
1097869393 12:64587660-64587682 CAAACCACCACCCTCTGCATTGG - Intergenic
1107393833 13:39995473-39995495 CAAAGTACCACCTGTGGCATTGG + Intergenic
1112951064 13:104997572-104997594 TCAGGTACCACCCTCTGCAATGG - Intergenic
1114822202 14:26034028-26034050 CAAGGCACCTCCCTTTGCCCAGG + Intergenic
1117477505 14:56111469-56111491 CCAGGTCCCACCCTCAGCATTGG - Intergenic
1119649472 14:76373539-76373561 CTAGGTCCCACACTGTGCATGGG - Intronic
1128553154 15:68611351-68611373 CAAGGTACCACCCTTTGCATTGG + Intronic
1129358932 15:75012379-75012401 CAAGGTACCACCCTCTCAGTGGG - Intronic
1131151477 15:90049923-90049945 CAGGCTTCCACCCCTTGCATAGG + Intronic
1134299782 16:12980051-12980073 CAAGGAACCACACTTTGAGTAGG + Intronic
1135040759 16:19115094-19115116 CAAGGCACCACCCTCACCATCGG + Exonic
1151432969 17:74077115-74077137 CAAGGACCCTCCATTTGCATTGG - Intergenic
1151482631 17:74379453-74379475 CAAGGGACAGCCCTTGGCATGGG + Intergenic
1155603703 18:27578498-27578520 CAAGGTACCACCTTTAGCTTTGG - Intergenic
1156520365 18:37717198-37717220 CCAGGGACAAACCTTTGCATGGG - Intergenic
1161879863 19:6941160-6941182 CCAGGGACCACGCTTTGGATTGG - Intergenic
1168058447 19:53876867-53876889 GAAGGTACCACCATGTGCTTGGG - Intergenic
1168553602 19:57320369-57320391 GAAGGCACCACCCCTTGCGTCGG + Intergenic
937456479 2:122045772-122045794 GAAGGTTTCAGCCTTTGCATAGG - Intergenic
941817537 2:169812776-169812798 AAAGGTACCATCATTTTCATAGG - Intronic
942543368 2:177037679-177037701 CAAGCTACCACATTTTGCAGGGG + Intergenic
942593651 2:177571782-177571804 CAAAGAACCAACCTTTGCAAAGG + Intergenic
944140371 2:196449861-196449883 CAAGAACCCACCCTTTGCAATGG + Intronic
947627087 2:231626467-231626489 CTAGGAACCATCCTTTGCAGGGG + Intergenic
1173179949 20:40798586-40798608 CAAGGGACCACCCTGTGCATGGG + Intergenic
1173348212 20:42220733-42220755 CAAGGTACAACCCTTTTTATAGG + Intronic
1173484505 20:43430523-43430545 AAAGTTACCACCCTTTGCCATGG + Intergenic
1174571260 20:51503490-51503512 CAATGTACCACCATTTGCACTGG + Intronic
1183148360 22:36016578-36016600 CAAGGAACCAGCCTATACATGGG + Intronic
951811864 3:26709459-26709481 CAATGTACCTCCCTTTGCAAAGG + Intronic
956075929 3:65505451-65505473 CAAGGTTTCACTATTTGCATAGG - Intronic
959674420 3:109018683-109018705 CAAGGAATCACCCTTTGCTCTGG - Intronic
962670139 3:137696620-137696642 CATGGTACCACCCTTTTCAAGGG - Intergenic
970111094 4:12639076-12639098 CAAGGTCCCTACCTTTGCAGAGG - Intergenic
970992578 4:22229988-22230010 CCATGTACCACCTATTGCATCGG - Intergenic
975714228 4:77190073-77190095 AAAGTTACCACCCTTTGGCTGGG - Intronic
976154216 4:82125398-82125420 GGAGGTGCCACCCTTTGCAGAGG - Intergenic
978132422 4:105214642-105214664 GAAGGTCCCACCCTTTGCACTGG + Intronic
980672886 4:136032344-136032366 CACGTTACCACCCTTTTCTTGGG + Intergenic
981450489 4:144891458-144891480 CAATGTACTACCCTTGGCAATGG + Intergenic
987229853 5:15882470-15882492 CATGGTACCACACTTTGGACAGG - Intronic
996791652 5:127299561-127299583 CAAGGTCACAGCCTTTGCAAAGG + Intronic
1012262917 6:97109042-97109064 CCATGTACCACACTTTGAATAGG - Intronic
1015809747 6:137149865-137149887 CAAGGGACCAGCATTTGCAAAGG - Intronic
1015872261 6:137789343-137789365 ATAGGTACCAATCTTTGCATGGG - Intergenic
1020086801 7:5314976-5314998 CAACCTACCACCCTTGGCCTTGG + Exonic
1021697683 7:23289936-23289958 CAAGGCAAAACCCTCTGCATTGG + Intergenic
1028439470 7:90842782-90842804 CCAGGTACCAACTTTTGCAATGG - Intronic
1037796643 8:22000982-22001004 CAAGGTATCAGCCCTTGCTTTGG + Intronic
1038020974 8:23551631-23551653 CAAGGAAAAGCCCTTTGCATGGG - Intronic
1051643225 9:19243014-19243036 CAAGATACCCCCCTTTAAATTGG - Intronic
1061880137 9:133564816-133564838 TCAGGGTCCACCCTTTGCATAGG + Intronic
1197654314 X:129099755-129099777 CAAGATGCATCCCTTTGCATGGG + Intergenic
1198166607 X:134063730-134063752 CTAGGGACTACCCTTTCCATAGG - Intergenic