ID: 1128554679

View in Genome Browser
Species Human (GRCh38)
Location 15:68623399-68623421
Sequence CCACATGCATGGACACTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128554679_1128554683 6 Left 1128554679 15:68623399-68623421 CCTGGCAGTGTCCATGCATGTGG 0: 1
1: 0
2: 0
3: 18
4: 182
Right 1128554683 15:68623428-68623450 GACGTGAGTGACAGCCAGTCTGG 0: 1
1: 0
2: 1
3: 8
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128554679 Original CRISPR CCACATGCATGGACACTGCC AGG (reversed) Intronic
900980358 1:6042774-6042796 CCACCTCCATGACCACTGCCTGG - Intronic
906796344 1:48699107-48699129 CCACATGCTGGGACAATGTCTGG - Intronic
909115103 1:71523611-71523633 CCAGATGCTTGGACTCTGCCTGG - Intronic
912333841 1:108844538-108844560 CCATTTTCATGGATACTGCCTGG - Intronic
913230771 1:116739233-116739255 CCACAAACATTGTCACTGCCAGG - Intergenic
918082936 1:181221502-181221524 CCACTTCCCTGGGCACTGCCTGG - Intergenic
918515558 1:185358993-185359015 CCACACACATGCACACTGCCAGG - Intergenic
920677058 1:208045517-208045539 TCACTTGGATGGACAGTGCCAGG + Intronic
922560921 1:226568991-226569013 GCACATGCATGGGCACAGCAAGG - Intronic
923914971 1:238491893-238491915 CCACATCCATGGGCTCTGCAAGG + Intergenic
924311415 1:242747370-242747392 ACACATGCATGCACACAGACAGG + Intergenic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1063673602 10:8119869-8119891 CCACATAAATGAACACAGCCAGG - Intergenic
1063977822 10:11431066-11431088 CCACATGCATGCAAGCTGCCTGG - Intergenic
1065829429 10:29600964-29600986 CCACATACATAGACACTCCCTGG + Intronic
1067787600 10:49261920-49261942 CCACATGCATGGACATTATTGGG + Intergenic
1069410600 10:68149330-68149352 CTATATGCATAGACAATGCCTGG - Intronic
1070810101 10:79293305-79293327 CCACATGCATTGAAAGTGCAGGG - Intronic
1071501088 10:86204814-86204836 GGAGAGGCATGGACACTGCCAGG - Intronic
1074571131 10:114625343-114625365 TCAGATGCATGCACGCTGCCTGG - Intronic
1074873476 10:117595929-117595951 CCTCATGCAGGGGCACTGCATGG - Intergenic
1075903936 10:126064597-126064619 GCACAGAAATGGACACTGCCTGG - Intronic
1075923743 10:126234646-126234668 CCACATAGGTGGACACTGTCAGG - Intronic
1076343883 10:129767406-129767428 TCACAGCCATGGACACAGCCAGG - Exonic
1076851995 10:133097858-133097880 CCACATGCAGGGACACAGGCAGG - Intronic
1077506157 11:2930841-2930863 CCACATCCCTGCCCACTGCCAGG - Intergenic
1082061610 11:47865945-47865967 CTACATACAAGGACATTGCCTGG - Intergenic
1084211798 11:67627824-67627846 CCACAGCAATGGACACTTCCTGG - Intergenic
1084225820 11:67714155-67714177 CCACCTGCATCCACACAGCCCGG - Intergenic
1084611577 11:70206499-70206521 CCACAGGCATCTACACAGCCTGG + Exonic
1084727060 11:70948751-70948773 CCACATGCACAGAGGCTGCCTGG + Intronic
1084809766 11:71605109-71605131 CCACCTGCATCCACACAGCCCGG + Intergenic
1084845223 11:71893556-71893578 CCAGATGCATGGACAGGGACAGG - Intronic
1086925844 11:92639922-92639944 CGACGTCCATGGACAATGCCAGG + Intronic
1088791448 11:113230781-113230803 CCACATGCCTAGACTCTTCCTGG + Intronic
1088915310 11:114223219-114223241 CCACATGAATGAATACTTCCAGG + Intronic
1089697565 11:120225554-120225576 CAGGATGCCTGGACACTGCCGGG - Intronic
1091153371 11:133350268-133350290 CCACACGCTAGAACACTGCCTGG + Intronic
1096818095 12:54214509-54214531 CCAGCTGCCTGGCCACTGCCTGG - Intergenic
1099764255 12:86961542-86961564 CTCCATGTATGGGCACTGCCTGG + Intergenic
1103464700 12:121132787-121132809 CCACATGTGGGGCCACTGCCAGG + Intergenic
1104226355 12:126838170-126838192 CCACTCCCAGGGACACTGCCTGG - Intergenic
1104893761 12:132152137-132152159 CCTCAGGCATGGACAGGGCCTGG - Exonic
1109532757 13:63673126-63673148 ACACATGCTTGGACAATGCCTGG + Intergenic
1114652654 14:24296060-24296082 CCACAGGCAAGGGCACTGCCGGG - Intronic
1118783313 14:69024912-69024934 CCTAATGCATGGACTCTGTCAGG - Intergenic
1119615293 14:76095054-76095076 ACACATCCATGGTCAATGCCGGG + Intergenic
1121155798 14:91682749-91682771 CTACATCTATGGTCACTGCCTGG - Intronic
1122940694 14:104979707-104979729 CCACACCCCTGGACATTGCCAGG - Intergenic
1123414795 15:20087473-20087495 CCAAATTCATGGACCCTGGCAGG - Intergenic
1123524137 15:21094587-21094609 CCAAATTCATGGACCCTGGCAGG - Intergenic
1124619315 15:31264976-31264998 CCACTGGAATGGACTCTGCCTGG - Intergenic
1125770796 15:42164506-42164528 CAAAATGAAAGGACACTGCCAGG + Intronic
1127864425 15:63020279-63020301 CCACTTGCAAGGACATTGCAAGG - Intergenic
1128366616 15:67008196-67008218 CCACATGATTGGGCACGGCCTGG - Intergenic
1128554679 15:68623399-68623421 CCACATGCATGGACACTGCCAGG - Intronic
1128753725 15:70166881-70166903 CCACAGGCAGGGACACTGGCAGG + Intergenic
1129613737 15:77082018-77082040 CCACATTCCTGGGTACTGCCCGG + Intronic
1129680799 15:77657388-77657410 CCACATTCATGAACACTGAGTGG - Intronic
1132007920 15:98247513-98247535 TCACATGCAAGGACACTCACAGG - Intergenic
1132537849 16:492241-492263 CCACCTGAATGGGCACTGGCTGG - Intronic
1132623110 16:877402-877424 CCTCATGCAGGAGCACTGCCAGG + Intronic
1136597322 16:31260290-31260312 CCACATTCATGGACTGTGCAAGG + Intronic
1137447285 16:48539576-48539598 TCACCTGCATGGGAACTGCCTGG + Exonic
1137566821 16:49538483-49538505 CCACATTCAGACACACTGCCTGG + Intronic
1138348579 16:56334675-56334697 CCAAATGCCTGGACACTGTTCGG - Intronic
1138993293 16:62417837-62417859 ACACATGCATGGGTACTGGCAGG + Intergenic
1139924613 16:70479292-70479314 CCACGTGCATGGCCAGAGCCTGG + Exonic
1140305758 16:73801028-73801050 CCAACAGCATTGACACTGCCTGG + Intergenic
1141281584 16:82634162-82634184 CCACATGCCTGGGCAGGGCCCGG + Intronic
1141623823 16:85251108-85251130 CCACAGGCATGCTCACAGCCGGG - Intergenic
1141680641 16:85541773-85541795 CCACATGCGTGTACTCTGTCAGG + Intergenic
1142259142 16:89034470-89034492 GCGCATGCATGGACACAGTCAGG + Intergenic
1142403461 16:89873289-89873311 CCACATGGATGGGCAAGGCCGGG + Intergenic
1143061259 17:4203270-4203292 CCTCATTCACTGACACTGCCAGG + Intronic
1143848558 17:9791836-9791858 CCACATGCATCCAAACTACCTGG - Intronic
1145999646 17:29123403-29123425 GCCCAGGCATGGACACTGGCTGG + Intronic
1146790020 17:35745843-35745865 CCCCATGCGTGGACCCAGCCAGG + Exonic
1150307351 17:64097169-64097191 CCACCTGCATGGGCCCTGCTTGG - Intronic
1151360095 17:73583658-73583680 GGGCTTGCATGGACACTGCCTGG + Intronic
1153098883 18:1441203-1441225 CCACATGCATGGGCACTCCTGGG + Intergenic
1153608625 18:6859283-6859305 CCAGCCGCATGGACACAGCCAGG + Intronic
1154344444 18:13530712-13530734 TGACATGCAGGGACCCTGCCAGG + Intronic
1154391180 18:13937469-13937491 CCAGATGCCTGGGCCCTGCCTGG + Intergenic
1156119623 18:33826278-33826300 CCAAATCCATGGTCACAGCCTGG - Intergenic
1160430650 18:78810208-78810230 CCACATGCATGCACACACACAGG + Intergenic
1161138199 19:2633115-2633137 CCACCTGCAGGGCCCCTGCCAGG - Intronic
1161262659 19:3346304-3346326 ACACAAGCGTGGCCACTGCCGGG - Intergenic
1161542862 19:4862571-4862593 CCAGCTGCATCAACACTGCCTGG - Intronic
1162672989 19:12273944-12273966 CCACATGCATCTACTCTGGCGGG + Exonic
925031257 2:651421-651443 CCTCATGCATGGGCTCTGCATGG + Intergenic
932091509 2:68809918-68809940 CTACCAGGATGGACACTGCCTGG + Intronic
933192682 2:79353549-79353571 CCACATGCAATGACACTCACAGG - Intronic
933467187 2:82667610-82667632 CTACATGCATGTACATTTCCAGG + Intergenic
935012023 2:99144376-99144398 CCCTATGAATGGACATTGCCTGG - Intronic
935348095 2:102127248-102127270 GCACATTCATGGACAGTGCATGG + Intronic
935960960 2:108425069-108425091 GCACATTGATGGACACTGGCTGG - Intergenic
937288828 2:120769611-120769633 GCACATGCATGAGCACTGCAGGG - Intronic
937299007 2:120827063-120827085 CCACTGGCATGGGCAGTGCCAGG - Intronic
940001150 2:148967241-148967263 CGACAGGAATTGACACTGCCTGG + Intronic
945095881 2:206218599-206218621 CCTCACTCATGGACACTGTCTGG + Intergenic
948547053 2:238740186-238740208 CCACCTGCCATGACACTGCCTGG - Intergenic
948852407 2:240714889-240714911 CCACTGCCATGGAGACTGCCTGG - Exonic
1168779948 20:480476-480498 CCACTTGCATGTAAACTCCCTGG - Intronic
1168891807 20:1299841-1299863 CTACATGCACGCACACTTCCTGG - Intronic
1169198369 20:3695234-3695256 ACACATGCAGGCACAGTGCCTGG - Intronic
1170298574 20:14856725-14856747 CCAGCAGCATGGACACTACCTGG - Intronic
1171294891 20:24008730-24008752 CCACATCCCTGCACACTACCAGG - Intergenic
1171992724 20:31708840-31708862 CCACCTGCAGTGACAATGCCAGG - Intronic
1172815179 20:37680563-37680585 TCACATGCATGCACGATGCCTGG + Intergenic
1173340543 20:42149032-42149054 CCACAGGAATGCACACTTCCAGG + Intronic
1176237463 20:64060336-64060358 CCACATCCATGGAGCCTGCCTGG - Intronic
1178320273 21:31600000-31600022 CCAGAAGCATGGGCAGTGCCTGG - Intergenic
1178923261 21:36754197-36754219 CCAGATGCATGGGCACGGACAGG + Exonic
1179960730 21:44765863-44765885 CAACATGCATGGCCACTGCAGGG + Intergenic
1182545313 22:31072093-31072115 CCAAATTCATGGACCCTGGCAGG + Intronic
1183837247 22:40464956-40464978 CTACAGGCAAGGACACAGCCAGG - Intronic
1184175081 22:42784513-42784535 CCAGGGGAATGGACACTGCCAGG - Intergenic
1184459211 22:44627736-44627758 GCACATGCATGGGCTCTGCGGGG - Intergenic
1185277175 22:49954818-49954840 CCTCATGGCTGGACACTGGCTGG + Intergenic
952495904 3:33915595-33915617 CCAGCAGCATGGACACTGCCTGG + Intergenic
952860002 3:37805188-37805210 CTACAGGCATGCACAATGCCTGG + Intronic
954629062 3:52038498-52038520 CCGCAGGCATGGTCGCTGCCAGG - Intergenic
954817010 3:53290473-53290495 CCACAGCAATGGACTCTGCCAGG + Intronic
958171725 3:89947499-89947521 CCAAATGCATGGGAACTGACTGG + Intergenic
962029297 3:131582583-131582605 ACAAATGCATGGACACTGAGAGG - Intronic
967989003 3:195117660-195117682 ACACATGCATGCACACATCCAGG + Intronic
968518730 4:1025844-1025866 ACACATGCACGGATATTGCCTGG + Exonic
968921225 4:3523131-3523153 CACCCTGCAAGGACACTGCCTGG + Intronic
969022159 4:4145918-4145940 CCACCTGCATCCACACAGCCCGG - Intergenic
969133691 4:5012387-5012409 CCACAGGCATGGAGGCTTCCAGG - Intergenic
969134150 4:5016563-5016585 CCACATAGATAGACTCTGCCAGG - Intronic
969214324 4:5710468-5710490 TCACTAGCCTGGACACTGCCTGG + Intergenic
969477970 4:7432013-7432035 CCAGCTGCAAGGACACTGCAGGG + Intronic
969791301 4:9495581-9495603 CCACCTGCATCCACACAGCCCGG + Intergenic
970093968 4:12441605-12441627 CCACTTACATAGACACTCCCTGG - Intergenic
970344719 4:15142366-15142388 GCATATGCATGGACACTCCCAGG + Intergenic
970634112 4:17988409-17988431 CCACAGGCATGCACCATGCCTGG + Intronic
971834706 4:31748329-31748351 CCAAGTGCATGCACACTGCCTGG + Intergenic
976008206 4:80456152-80456174 CCCCATGCTTGGACACAGCAAGG + Intronic
976087435 4:81420780-81420802 TCAGATGCTTGGACACTGTCAGG + Intergenic
976617651 4:87094598-87094620 CCACATGGAAGCACTCTGCCAGG - Intronic
977028349 4:91849597-91849619 CCACATAGATGGACTCTTCCTGG + Intergenic
977913765 4:102567049-102567071 CCACCTGCATGCCCACAGCCTGG + Exonic
978709360 4:111759348-111759370 CCAGAAGCAAGGACAGTGCCTGG + Intergenic
980133479 4:128838125-128838147 CCATGAGCATGGACCCTGCCCGG - Intronic
981026689 4:140083798-140083820 CCAAATGCTTGTAAACTGCCTGG - Intronic
983114668 4:163798922-163798944 TAATATGCATGGACAGTGCCGGG - Intronic
984633339 4:182083855-182083877 ACACATGTATGGACTCTCCCTGG + Intergenic
985900217 5:2782936-2782958 CCACCAACAAGGACACTGCCAGG - Intergenic
986034363 5:3924056-3924078 CCACACACATGAACACAGCCGGG - Intergenic
987061542 5:14248508-14248530 GCAGGTGCAGGGACACTGCCTGG - Intronic
992141719 5:73803943-73803965 CCACAGGCATGTACCATGCCCGG - Intronic
992199152 5:74367267-74367289 CCACATGCGTGGACACACCCAGG + Intergenic
994180068 5:96754398-96754420 CCACCTGCATTGACATTGCTGGG + Intronic
995899971 5:117054016-117054038 CCACATGGATGTGCACTTCCAGG + Intergenic
997725948 5:136120000-136120022 CCACATGCATGCCTGCTGCCAGG - Intergenic
997880087 5:137581674-137581696 CAAGAGGCAGGGACACTGCCAGG - Intronic
1001275359 5:170346861-170346883 CCACAGGTATGGACACTGGCTGG - Intergenic
1002432092 5:179209600-179209622 ACACATGCATGTACACAGCAAGG + Intronic
1002480771 5:179499345-179499367 CCACAGGGATGGACCGTGCCTGG + Intergenic
1004982927 6:21046518-21046540 CCACAGCCATGAGCACTGCCTGG - Intronic
1011082677 6:83507026-83507048 CCACCTCCATGGCTACTGCCTGG + Intergenic
1016307940 6:142702893-142702915 CCACACACAGTGACACTGCCTGG + Intergenic
1016906588 6:149156893-149156915 CCATATTCATGGGCACTGCCTGG - Intergenic
1016906600 6:149156974-149156996 CCATATTCATGGGCACTGCCTGG - Intergenic
1018629041 6:165806292-165806314 CCACATGAATAGACAGTGACAGG - Intronic
1018914995 6:168127714-168127736 TCCCATGCATGCACACTGCATGG - Intergenic
1019580493 7:1759505-1759527 CAACAGGCATGGAAAATGCCAGG - Intergenic
1019857159 7:3620742-3620764 TCAAAGGCATGGACACTCCCTGG + Intronic
1020002851 7:4765503-4765525 CCACATTCCTGCACATTGCCCGG - Exonic
1020309582 7:6857960-6857982 CCACCTGCATCCACACAGCCTGG - Intergenic
1020726689 7:11823840-11823862 CTACATGCATGGAAACCACCTGG + Intronic
1021598391 7:22340758-22340780 GCACAGGCATGGCCACTTCCTGG + Intronic
1023315702 7:38934242-38934264 CAACATGCCTGAACACTGCTTGG + Intergenic
1031145193 7:117989689-117989711 AAACATGCATAGACAATGCCAGG - Intergenic
1033368197 7:140687208-140687230 CCACAGCCATGAAAACTGCCCGG - Exonic
1034911442 7:155002278-155002300 CCACGTGCAGGGACACAGGCTGG + Intronic
1035950401 8:4013500-4013522 CCATCTGCCTGGTCACTGCCTGG - Intronic
1036498456 8:9292094-9292116 CCAATTGCATGGACATTACCAGG - Intergenic
1038489434 8:27959282-27959304 CAACATCCATGGTCACAGCCTGG + Intronic
1044100952 8:88138148-88138170 CAATATGTATGCACACTGCCTGG - Intronic
1045291325 8:100835257-100835279 CCCCATGCAAGGATACTCCCGGG + Intergenic
1047545390 8:125811538-125811560 CCAAAGGCAGGGACACTGTCTGG + Intergenic
1047780736 8:128109085-128109107 CCACATGCCTCCAGACTGCCAGG - Intergenic
1048026430 8:130591484-130591506 CTACATGCATGGTCTGTGCCAGG - Intergenic
1049709970 8:144059061-144059083 CCTCAGGCATGGGCACGGCCTGG + Exonic
1055405989 9:75974186-75974208 CGACACACATGGAGACTGCCAGG + Intronic
1055884246 9:81040357-81040379 CCAAATGGCTAGACACTGCCTGG + Intergenic
1056310365 9:85334595-85334617 CCAAATGCCTGAACTCTGCCAGG - Intergenic
1056964755 9:91156326-91156348 CCAGAGGCATGAACATTGCCAGG - Intergenic
1058262714 9:102856094-102856116 ACACATGCATGCACACACCCAGG - Intergenic
1061269697 9:129531490-129531512 GCACATGCATGGACATTGAGTGG - Intergenic
1061302215 9:129711909-129711931 CCACATCCTTAGCCACTGCCTGG - Intronic
1061671116 9:132188671-132188693 GCACATTCATGGCCACTGTCTGG - Intronic
1190311806 X:49122323-49122345 CTACGTGCAGGGACACAGCCTGG + Intronic
1192727814 X:73770177-73770199 CCTCATGCATGGGACCTGCCCGG + Intergenic
1195355306 X:104033865-104033887 CCACATGCAAGGACAAATCCAGG - Intergenic
1196712348 X:118775998-118776020 GCACATCCATGGACACTCACTGG + Intronic
1197775824 X:130118140-130118162 CCACCTGCTTGCACACTTCCGGG - Intergenic
1200096324 X:153665799-153665821 CCACATGCCCAGACAGTGCCTGG + Intergenic