ID: 1128555990

View in Genome Browser
Species Human (GRCh38)
Location 15:68631995-68632017
Sequence CTGTTGACCTTTAGTAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128555987_1128555990 25 Left 1128555987 15:68631947-68631969 CCTCAGCATCGCTGGAGTGGGCT 0: 1
1: 0
2: 2
3: 8
4: 127
Right 1128555990 15:68631995-68632017 CTGTTGACCTTTAGTAATGAGGG 0: 1
1: 0
2: 0
3: 1
4: 135
1128555983_1128555990 30 Left 1128555983 15:68631942-68631964 CCATCCCTCAGCATCGCTGGAGT 0: 1
1: 0
2: 0
3: 16
4: 244
Right 1128555990 15:68631995-68632017 CTGTTGACCTTTAGTAATGAGGG 0: 1
1: 0
2: 0
3: 1
4: 135
1128555986_1128555990 26 Left 1128555986 15:68631946-68631968 CCCTCAGCATCGCTGGAGTGGGC 0: 1
1: 0
2: 0
3: 17
4: 89
Right 1128555990 15:68631995-68632017 CTGTTGACCTTTAGTAATGAGGG 0: 1
1: 0
2: 0
3: 1
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128555990 Original CRISPR CTGTTGACCTTTAGTAATGA GGG Intronic
902234383 1:15048262-15048284 CTATTGGCATTTAGCAATGAAGG + Intronic
906837369 1:49098496-49098518 CTTTTGCCCTTTAGAGATGATGG - Intronic
908229570 1:62090415-62090437 CTATTGACTTTTAGTGATTATGG + Intronic
909592531 1:77366941-77366963 CCGTTGACATTTAACAATGATGG - Intronic
909592605 1:77368015-77368037 CCGTTGACTTTTAACAATGATGG + Intronic
912156552 1:106928140-106928162 CTACTGACATTTAGTAGTGAGGG - Intergenic
913126838 1:115798806-115798828 CTGTTTTCCTTTAGGAATAAAGG - Intergenic
914423685 1:147554444-147554466 CTGTTTATCCTTAGTAATGGAGG + Intronic
916349784 1:163836229-163836251 CTTTTGACCTTTTGCAATAAGGG - Intergenic
921778346 1:219129352-219129374 CAGTGGACCTTTTGTGATGATGG + Intergenic
923981370 1:239327717-239327739 CTTTTGACCTTTGCCAATGAAGG - Intergenic
1062808086 10:439693-439715 CTTTATACCTTTACTAATGAAGG - Intronic
1062870118 10:893912-893934 CTGTTGTCCTTTAGTGATCTTGG - Intronic
1065672125 10:28131318-28131340 CTGTTGACATTTATGAAAGAAGG - Intronic
1066498069 10:35961763-35961785 CTTTTCACCTTCAGTGATGATGG - Intergenic
1067055512 10:43047565-43047587 CAGTTCACCTTTAAAAATGATGG - Intergenic
1068689273 10:59899558-59899580 CTGGTGACCTGTAGCAGTGATGG - Intronic
1072689690 10:97563892-97563914 CTGTTATCCTTTAGGAATGCAGG + Intronic
1073073847 10:100811059-100811081 CTGTTCACCAGTGGTAATGACGG + Intronic
1074647379 10:115474197-115474219 ATGTTGCCCTTCAGAAATGAAGG - Intronic
1075226707 10:120635965-120635987 CTGTGGACATTTATTATTGATGG - Intergenic
1078147738 11:8733286-8733308 CTGATGACCTTTTGTATTTATGG - Intronic
1079216616 11:18518899-18518921 CTGTAGACCCTTAGTTATGCTGG - Intronic
1079433178 11:20416888-20416910 TTGTTGACATTTATGAATGAAGG + Intronic
1080037209 11:27722200-27722222 CTGGAGACCCTTAGTCATGATGG - Intergenic
1080953270 11:37062342-37062364 ATGTTGACCTTTGATTATGAGGG + Intergenic
1082917431 11:58452790-58452812 AAGTTGTCCTTTAGAAATGAAGG + Intergenic
1092198408 12:6564112-6564134 CTGTTGAAACTAAGTAATGAGGG + Intronic
1093788589 12:23220613-23220635 GTGTTGGCCCTTAGGAATGATGG - Intergenic
1095140423 12:38656267-38656289 ATGTTAACATTTAGTAATGTTGG + Intronic
1095785860 12:46108488-46108510 CTTTTGACATTCACTAATGATGG + Intergenic
1098505659 12:71247625-71247647 CTGGTGACCTTGGGTAGTGATGG - Intronic
1098655870 12:73028523-73028545 CTGTTGATCTTTGGTACTGTGGG + Intergenic
1102110485 12:110361850-110361872 ATTTTGACCTTGAGTAAGGAAGG + Intergenic
1102892386 12:116570157-116570179 CCTGTGAACTTTAGTAATGAGGG - Intergenic
1103873045 12:124105086-124105108 CTGTTAACATTTATTAATGCAGG + Intronic
1107957456 13:45529996-45530018 CTGTAGACATTTAGAAATGTTGG + Intronic
1110714558 13:78686291-78686313 CTGTTGACCAATATGAATGACGG + Intergenic
1110974679 13:81815419-81815441 TTGTTGACCTTTTGTATAGAAGG - Intergenic
1112276885 13:98029370-98029392 CTATTGACCATTTGTAATAATGG - Intergenic
1112884523 13:104152178-104152200 CAGTTGACCCTTAGTTAAGACGG - Intergenic
1113954683 13:114091404-114091426 CTGTTGAGTTTTTGTCATGAGGG + Intronic
1115061155 14:29191948-29191970 CAGTTGACTTTTAGTATTTAAGG + Intergenic
1117320277 14:54615485-54615507 CTGTGGTCCTTTAGAATTGATGG + Intronic
1121942279 14:98082522-98082544 TTGTTTACCTTTGGAAATGAGGG + Intergenic
1123159833 14:106267790-106267812 CAGTTGACCATTAATACTGAAGG - Intergenic
1126738238 15:51752331-51752353 CTGTTGACCTGCGGAAATGAAGG + Intronic
1127777480 15:62277370-62277392 CTTATCACCTTTGGTAATGAGGG - Intergenic
1128555990 15:68631995-68632017 CTGTTGACCTTTAGTAATGAGGG + Intronic
1132387995 15:101415371-101415393 CTGTTGCCATTAAGGAATGAGGG + Intronic
1133202305 16:4211402-4211424 CTGTTGTCCTTCAATGATGATGG + Intronic
1133885419 16:9823064-9823086 CTGTTGATCTTTAGCTATCAGGG + Intronic
1135062772 16:19285197-19285219 TTGTTGCCCTGTAGAAATGAGGG + Intergenic
1136568917 16:31085354-31085376 TTGGTTACCTTCAGTAATGAGGG - Intronic
1138281837 16:55778140-55778162 CTGGGGACCTTTAGGATTGATGG + Intergenic
1140857446 16:78990450-78990472 CTGTTGACCTTTAGTAGCTCCGG - Intronic
1142327226 16:89423639-89423661 TTTTTGACCTCTAGTAATGGTGG - Intronic
1148283672 17:46369347-46369369 CTGTAGACTTTGAGTAAAGAAGG - Intergenic
1148305890 17:46587264-46587286 CTGTAGACTTTGAGTAAAGAAGG - Intergenic
1158279481 18:55805896-55805918 CTGTTGACATCAAGTATTGATGG + Intergenic
1164839905 19:31385311-31385333 ATTTTCACCTATAGTAATGATGG - Intergenic
925044510 2:761782-761804 CTGTTTTACTTTAGTAATTAGGG + Intergenic
925186721 2:1852009-1852031 CTGCTGAGCTTTAAGAATGAGGG - Intronic
926003289 2:9351706-9351728 CAGTTGACCTGTATTATTGAGGG + Intronic
931658919 2:64538337-64538359 TGGTTGACCTTTTTTAATGATGG - Intronic
931823583 2:65976721-65976743 TTTTTGATCTTTAGTAAAGAAGG + Intergenic
933469649 2:82705373-82705395 TTTTGGACCTTTAGTGATGAAGG - Intergenic
938622880 2:133075394-133075416 CTGTGGAACTTCAGAAATGAGGG + Intronic
941320686 2:164050383-164050405 CTGTTGACTTTTACTGTTGAAGG + Intergenic
941770399 2:169338669-169338691 CTGTTGACTTTTAGACATGCTGG - Intronic
943974366 2:194452556-194452578 CTGTTTACCTTTTATAAAGAAGG + Intergenic
944241474 2:197489684-197489706 TTTTTTACTTTTAGTAATGACGG - Intronic
944739804 2:202600814-202600836 CTTTTAATCTTTAGTAGTGAAGG - Intergenic
1169437480 20:5605812-5605834 CTGTAGAACCTGAGTAATGATGG - Intronic
1169727088 20:8747040-8747062 CTGGTAACCTTTAGCAAGGATGG + Intronic
1171510440 20:25678773-25678795 TTTTTAACCTTTTGTAATGATGG - Intronic
1182665012 22:31951697-31951719 TTTTTGACATTTAGTAATGTTGG + Intronic
966489708 3:180514579-180514601 CAGTTGACCTTAAGTAAAGCAGG - Intergenic
970265560 4:14280181-14280203 CTGTTAACCTTCAGTGGTGAAGG - Intergenic
971609667 4:28706868-28706890 CTGTTTATGTATAGTAATGATGG + Intergenic
972379470 4:38505609-38505631 CTGTTGACATTTTGGGATGATGG - Intergenic
973692568 4:53452705-53452727 CTGTTCACCTTGTATAATGAAGG + Intronic
974831894 4:67199946-67199968 CATTTGACCCTTAGTAATGGAGG - Intergenic
976621826 4:87136219-87136241 CTGTAAACCATAAGTAATGAAGG + Exonic
980132346 4:128828549-128828571 CTGAAGATCTTGAGTAATGAGGG - Intronic
983820488 4:172187708-172187730 CTGTTGGCCTTTGATAATTATGG + Intronic
984009878 4:174357913-174357935 CTATTGCCCTGTAGAAATGAAGG - Intergenic
986870949 5:12045577-12045599 CTGTTGTCATTGAGAAATGAAGG + Intergenic
988105408 5:26740623-26740645 CTCTTGACCTTTAGTGAGTAAGG + Intergenic
988979192 5:36548001-36548023 CTGTTAAACTTTAGAAATAAAGG + Intergenic
990772490 5:59264892-59264914 CTGTTGTTCTTTAGAAATGATGG + Intronic
999750230 5:154622935-154622957 CAGTTGGCTTATAGTAATGAAGG - Intergenic
1002687192 5:181022382-181022404 AAGTTGTCCTTTAGAAATGAGGG + Intergenic
1002687201 5:181022508-181022530 AAGTTGTCCTTTAGAAATGAGGG - Intergenic
1003513940 6:6803214-6803236 CTGTTCATCATTAGCAATGACGG - Intergenic
1004097689 6:12574821-12574843 TTGTTGACATTTAGTAATATGGG - Intergenic
1005019371 6:21402916-21402938 CTGTTTAACTTTTGAAATGAAGG + Intergenic
1006224423 6:32524613-32524635 CGTTTGCCCTTTAGAAATGATGG + Intronic
1008897189 6:56569709-56569731 TTGTTGACCTTTGGAAATCATGG - Intronic
1012403489 6:98866264-98866286 CTGAAGAACTATAGTAATGAAGG + Intergenic
1014240584 6:119013995-119014017 ATGTAGGCATTTAGTAATGATGG - Intronic
1014661976 6:124183532-124183554 ATGTTTATATTTAGTAATGATGG + Intronic
1016574334 6:145550982-145551004 CAGTTGACCTTCATTAATGTGGG - Intronic
1016756097 6:147688850-147688872 ATTTTGACCTTTGGTGATGATGG - Intronic
1021143487 7:17056231-17056253 CTGTTTCCATTTAGTAATCAAGG - Intergenic
1024011578 7:45271387-45271409 CGGATGACCTTCAGTAGTGAGGG - Intergenic
1026057074 7:66994454-66994476 CTGATGACCTTTAGTGTAGAGGG + Intronic
1026325260 7:69303893-69303915 CTGTTAACATTTAGTGATGTGGG - Intergenic
1026721027 7:72830557-72830579 CTGATGACCTTTAGTGTAGAGGG - Intergenic
1030001096 7:105063620-105063642 CTGATAACCTTTGGTAATGTTGG + Intronic
1032677183 7:134141884-134141906 CTATTTACATTTAGTAAGGAAGG + Intronic
1036293274 8:7514429-7514451 CTGTTGAGTTTCAGTGATGAAGG - Intergenic
1036329282 8:7806572-7806594 CTGTTGAGTTTCAGTGATGAAGG + Intergenic
1037793192 8:21966277-21966299 CTGCTGAACTTTAGACATGAGGG + Intronic
1040706019 8:50128220-50128242 CTGTTCACCATCAGTAATGGAGG - Intronic
1041038413 8:53819915-53819937 TTGTCGACCTTTATTTATGAAGG - Intronic
1043317164 8:78937273-78937295 CAGTTGACTTTTAGTAAAGGGGG - Intergenic
1046292615 8:112182615-112182637 CAGTTGACCTTGAACAATGAGGG - Intergenic
1050074944 9:1853572-1853594 CTTTGGACTTTTAGTAATGCTGG + Intergenic
1050372710 9:4938169-4938191 CTCTTCATCTTTAGAAATGATGG - Intergenic
1051814206 9:21086768-21086790 AAGTTGACCTTCAGAAATGAGGG + Intergenic
1051846502 9:21457125-21457147 CTGGTGACCTTGACCAATGATGG + Intergenic
1054775891 9:69123007-69123029 CTGTCGACCTTTTGAAATGCAGG + Intronic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1057611863 9:96551623-96551645 CTGTTGACGTTTTGTCATGGAGG - Intronic
1058562558 9:106245466-106245488 CTGCTGACCTCTAGAACTGAAGG - Intergenic
1058999858 9:110337176-110337198 CTCTTGACTTCTTGTAATGAGGG + Intronic
1059623730 9:116037882-116037904 CTGTTTACCTGGAATAATGATGG + Intergenic
1060459407 9:123835442-123835464 CTGTGTCCCTCTAGTAATGAAGG + Intronic
1187314061 X:18175547-18175569 TTGTTCACTTTTAGTGATGATGG - Intronic
1187521555 X:20018980-20019002 CTTTGGAGGTTTAGTAATGACGG - Intronic
1187532177 X:20107025-20107047 CTTTGGAGGTTTAGTAATGACGG + Intronic
1188704465 X:33308734-33308756 CTGTTGTTCCTTAGTATTGAGGG + Intronic
1192773316 X:74216221-74216243 CTGTTGGCCTTTAGCACTGCTGG - Intergenic
1193413267 X:81190851-81190873 CAACTGACCTTTAATAATGAAGG - Intronic
1193498973 X:82249634-82249656 CTCTTCACCTTCAGTCATGATGG - Intergenic
1198029381 X:132740377-132740399 CTGTTCTCCTTTGGTATTGATGG - Intronic