ID: 1128557235

View in Genome Browser
Species Human (GRCh38)
Location 15:68640085-68640107
Sequence TCACTGTGAGGTCAGATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128557235_1128557241 25 Left 1128557235 15:68640085-68640107 CCATGCATCTGACCTCACAGTGA 0: 1
1: 0
2: 2
3: 16
4: 203
Right 1128557241 15:68640133-68640155 CTTCTGCAGACACCCAGCTTTGG 0: 1
1: 1
2: 1
3: 23
4: 211
1128557235_1128557238 0 Left 1128557235 15:68640085-68640107 CCATGCATCTGACCTCACAGTGA 0: 1
1: 0
2: 2
3: 16
4: 203
Right 1128557238 15:68640108-68640130 GGTCAGCTCCTTAGTAATGCAGG 0: 1
1: 0
2: 1
3: 9
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128557235 Original CRISPR TCACTGTGAGGTCAGATGCA TGG (reversed) Intronic
902198388 1:14815245-14815267 TCTCTGTGAGGTCAGTGGAAGGG + Intronic
902521496 1:17020302-17020324 TCACTGTCAGGTCAGTGGGAAGG - Intronic
902672533 1:17984790-17984812 TCACTGTGTGGTGTGATGCAAGG - Intergenic
903730982 1:25495074-25495096 TCAGTGTAAGGTCAGAAGCTCGG - Intronic
905346030 1:37311753-37311775 CCTCTGGGAGGGCAGATGCAGGG - Intergenic
905883683 1:41480420-41480442 TTGCTGTGAGGTCAGATGAGTGG - Intronic
906518841 1:46455657-46455679 TCACTCTGTGGCCAGAGGCAGGG + Intergenic
907240090 1:53076391-53076413 TCACTGAGATGGCAGACGCAGGG - Intronic
908822510 1:68102857-68102879 ACACAGTGAGGTCAGGTGCAGGG - Intronic
908835941 1:68230440-68230462 TCACTGTGAGGGCACAGGGAAGG + Intronic
909443394 1:75722764-75722786 TCATTGTGAGATCAAATGAAGGG - Intergenic
912158305 1:106949478-106949500 TCACTGAGATGTCAGCTTCATGG + Intergenic
912237662 1:107869147-107869169 TCACTATGTGGTCAAAGGCATGG + Intronic
912462440 1:109844953-109844975 TCACCAAGGGGTCAGATGCATGG + Intergenic
912801750 1:112723778-112723800 TCACTGTCTGGGGAGATGCAGGG + Intronic
912937129 1:114013371-114013393 ACACTGTGAGATGAGATGAAGGG - Intergenic
913253289 1:116930460-116930482 TCAATGTGGAGTCACATGCACGG - Intronic
913549069 1:119898719-119898741 TCTCTGTGACGTCAGCTGCTGGG + Intergenic
916975062 1:170067649-170067671 TTCCTTTGAGGTCAGCTGCAAGG + Intronic
917968962 1:180195237-180195259 TCCCTGAGAGGCCAGAAGCAGGG + Intronic
920613084 1:207461256-207461278 TCACAGTGAGGTCAGAGTCTGGG - Intronic
920732998 1:208505504-208505526 TCCCTGTTAGCTCAGATCCAGGG + Intergenic
922224051 1:223629928-223629950 TCAATGTGTGTTCAGATGGAAGG + Intronic
1062862528 10:821990-822012 TCCCTGTGAGGCCACAGGCATGG - Intronic
1063116302 10:3074344-3074366 TCACTGTCAGGTCAGGTCAAAGG - Intronic
1065376813 10:25051526-25051548 TCACTGTGAAGGCAGGAGCAAGG + Intronic
1066105838 10:32156288-32156310 TCTCTGTGAAGTAAGAGGCAAGG + Intergenic
1067509998 10:46886599-46886621 TCACTGTGAGGTCACAGGCAAGG + Intergenic
1067770945 10:49124722-49124744 TCAGTGTAAAGACAGATGCAAGG - Intergenic
1070493376 10:76998589-76998611 TCAAAGTGAGGTCAGATGGGCGG - Intronic
1070677221 10:78420456-78420478 TCACTGTGTGGTCAGCAACATGG + Intergenic
1072932594 10:99679866-99679888 TCCCTGAGAGGTGAGATGCAGGG + Exonic
1074322463 10:112415943-112415965 TCACAGTGAGGTCAGAGTCAGGG + Intronic
1075625008 10:123956755-123956777 TCACTGTAACCTCAGATGCCTGG - Intergenic
1075796314 10:125122382-125122404 TCACTGTGAGATTAGATTCTTGG + Intronic
1076421854 10:130337494-130337516 TTGCTGTGAGGTCAGCTCCAAGG + Intergenic
1077135767 11:997515-997537 TAACAGCGAGGCCAGATGCAAGG - Intronic
1080944348 11:36954299-36954321 TCACTTTGAGGTGAGAAACAAGG + Intergenic
1082201121 11:49368959-49368981 TCCCTGTGAGGACAAATGGAAGG - Intergenic
1084517526 11:69644751-69644773 TCACAGGGGGGTCAGAGGCAGGG - Intronic
1085229298 11:74950834-74950856 TGAGTGTGAGGCCAGGTGCATGG - Intronic
1089659438 11:119976318-119976340 TCACTGTGTGGTCTGGGGCAAGG + Intergenic
1091521615 12:1250118-1250140 TCATCTTGAGGTCAGATGCTTGG + Intronic
1093806052 12:23434504-23434526 TCACTGTCAGGACAGTGGCAAGG - Intergenic
1095745547 12:45654316-45654338 TGACTTTGAAGTCAGAAGCAAGG - Intergenic
1096322520 12:50627787-50627809 CCCCTGTGAGGTCACCTGCAAGG - Intronic
1099625492 12:85067833-85067855 TCAATGTGAGGTAAGAGGAAAGG - Intronic
1103548292 12:121717290-121717312 TCACTGTGAGGTCAGACTTAGGG - Intronic
1103795430 12:123499847-123499869 TCACTGAGTGGTCAGAGGAAGGG - Intronic
1104044100 12:125149711-125149733 TCACTGTGAGGACATAAGCCTGG - Intergenic
1104405593 12:128513859-128513881 TCACTTTTTGGTCAGCTGCAAGG - Intronic
1104753478 12:131254554-131254576 TCACTGTGGGGGCACATGCCTGG - Intergenic
1104917262 12:132272122-132272144 GCACCGTGGGGACAGATGCACGG + Intronic
1105659167 13:22474028-22474050 TCACAGTGAATACAGATGCATGG - Intergenic
1106102317 13:26705750-26705772 TCACTGTGACTTCACATGGAGGG + Intergenic
1109856931 13:68142577-68142599 TCCCTGAGAGGTGAGATGAAAGG + Intergenic
1112920563 13:104606393-104606415 GCACAGTGAATTCAGATGCACGG + Intergenic
1113561981 13:111288543-111288565 TCACTGGGAGGTCAGGCGCATGG - Intronic
1113658951 13:112090866-112090888 TCAGTGTGAGTTTACATGCATGG - Intergenic
1117444967 14:55795402-55795424 TCAATGTGGGGACAGCTGCAGGG + Intergenic
1119136777 14:72228547-72228569 GCAAGGTGAGGTCAGAGGCAGGG + Intronic
1119834214 14:77733018-77733040 TCATTGTGAAGAAAGATGCAAGG - Intronic
1120844801 14:89116287-89116309 TCAGTGTGAGTTCAAATCCAGGG - Intergenic
1121602630 14:95217476-95217498 TCACTGGCAGGTCAGAGGCCAGG + Intronic
1125151465 15:36537184-36537206 ACACTTTGAGGACAGAAGCAAGG + Intergenic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1125765144 15:42130648-42130670 TCACTGGGGGGTCTGAGGCATGG - Intergenic
1126668085 15:51093293-51093315 CCTCTGTGGGGTCTGATGCAGGG + Intronic
1128557235 15:68640085-68640107 TCACTGTGAGGTCAGATGCATGG - Intronic
1130726346 15:86443253-86443275 TCCCTGTGTGATCAGATGGATGG + Intronic
1131448369 15:92518556-92518578 GCACTCTGAGGTCAGAGGGATGG - Intergenic
1131955628 15:97732419-97732441 TCACTGTGAGGTCATACGAATGG + Intergenic
1132661811 16:1064977-1064999 GCCCTGTGAGGACAGAGGCAGGG - Intergenic
1134163211 16:11909158-11909180 CCACTGTTAGGTCAGGTGCTCGG + Intronic
1134443558 16:14313905-14313927 GCAGTGTGACCTCAGATGCAGGG + Intergenic
1137837254 16:51604624-51604646 TCACAGTGCTGTCAAATGCATGG - Intergenic
1141396676 16:83711153-83711175 TATCTGTGACTTCAGATGCAGGG + Intronic
1142044020 16:87913723-87913745 TCACTGGGAGGTGAGGTGCTCGG - Intronic
1142640255 17:1281302-1281324 TCAGAGTGAGGTCAGGGGCAGGG + Intronic
1142781751 17:2186659-2186681 TCACTGCGAGGGCAGATCCAGGG + Exonic
1143032986 17:3978028-3978050 TCACTGTGAAGTGGGAAGCACGG + Intergenic
1145024202 17:19455562-19455584 TCACTGTGAGGAGAGAGGGAAGG - Intergenic
1145247516 17:21279343-21279365 TCACTGTGATGCAAGCTGCACGG - Intergenic
1146913146 17:36660835-36660857 CCACTGTGAAGACAGATGAAGGG - Intergenic
1150769153 17:68026562-68026584 TCACTGTGAGGTGAGTTTCTTGG - Intergenic
1151190246 17:72393000-72393022 TGCCTGTAAGGGCAGATGCAAGG - Intergenic
1154134345 18:11762516-11762538 TCAGTGTGACGCCAGCTGCATGG - Intronic
1154326022 18:13390948-13390970 TCCCTGTGATGTAGGATGCAGGG + Intronic
1155347268 18:24870337-24870359 TGACAGTGAGGCCAGATGCTGGG + Intergenic
1156371984 18:36479521-36479543 CTACTGTTAGGACAGATGCAAGG - Intronic
1156436100 18:37131555-37131577 TCACTGTTAGGTGTGATGCTGGG - Intronic
1157303945 18:46502861-46502883 TCACTATGAGACCAGAAGCACGG - Intronic
1157765767 18:50296129-50296151 TGACTGGGAGGCCAGGTGCATGG - Intergenic
1157849783 18:51037381-51037403 TCACTGTGAGGACATTTGTATGG + Intronic
1160774318 19:848131-848153 TCACGGTGGGGTGAGGTGCAGGG - Exonic
1161975488 19:7606040-7606062 GGACTTTGAGGTCAGATGCTAGG - Intronic
1164530635 19:29045831-29045853 TGACTGTGAGCTCAGATGCAGGG + Intergenic
1166420872 19:42635022-42635044 TAAGTGTGAGTTCAGATGGAGGG - Intronic
1167558070 19:50207872-50207894 TCACTGTGAGGTAGGCAGCATGG - Intronic
925088949 2:1137614-1137636 TCCCTGTCTGGTCAGCTGCAGGG - Exonic
931090375 2:58879505-58879527 TCACTGTGGGTCCAGATGTATGG + Intergenic
932083788 2:68739373-68739395 TAACTGTGAGGTGAGAGACAGGG - Intronic
932220229 2:69993495-69993517 TCACTGTGATCTCAGGTTCAGGG - Intergenic
932803259 2:74761657-74761679 TCATTGTGAGGTCAGGAGCAGGG - Intergenic
939170010 2:138684797-138684819 TGACTCTGAGGGCAGATCCATGG - Intronic
939463099 2:142522924-142522946 TCACTGTGAAAACAGATTCAAGG - Intergenic
943245542 2:185445213-185445235 TCACTATGAAGTAAAATGCAAGG - Intergenic
945781656 2:214181860-214181882 TCACTGTGATGCAAGAGGCATGG - Intronic
946027421 2:216680159-216680181 TCACAGTGGGACCAGATGCAGGG + Intronic
948607478 2:239145343-239145365 TCACCCTGTGGTCAGATGAAAGG - Intronic
948771892 2:240255440-240255462 TCACTGAGAGGGCAGAAGGAAGG - Intergenic
1169075308 20:2756432-2756454 TCACTGGGAGGACAGAGGAAGGG + Intronic
1171493764 20:25539798-25539820 TCTGTGTGAGGGCAGAGGCAAGG + Intronic
1173430345 20:42982292-42982314 GCTCTGTGAGGACAGATGGATGG - Intronic
1173519857 20:43691169-43691191 TCACGCTGACCTCAGATGCAAGG - Intronic
1174526339 20:51174913-51174935 TGGGTGTGAGGTCAGATGGAAGG + Intergenic
1175262010 20:57680637-57680659 TCAATGTGAAGACAGAAGCAGGG + Intronic
1175386726 20:58600807-58600829 TGACTGTGATGACAGGTGCATGG - Intergenic
1175879681 20:62250026-62250048 TCACTCTGAGCTCAGCTCCAGGG + Intronic
1176665357 21:9681798-9681820 TGACTCTGAGGTAAGAAGCACGG - Intergenic
1176992072 21:15508940-15508962 TCAATGTGAGTACAGATGCAAGG + Intergenic
1179155768 21:38849774-38849796 TCACTGTGAAGACAGAGGAAGGG + Intergenic
1179515520 21:41903793-41903815 CCACTGTGGGTTCTGATGCATGG - Intronic
1180141901 21:45898155-45898177 TCTCTGTGAGGCCAGGTGCACGG + Intronic
1180192676 21:46173577-46173599 TCAGTGTTAGGTCAAAGGCAGGG - Intronic
1180259659 21:46660540-46660562 TCCCTGTGAGGTCTCATTCATGG - Intronic
1181392683 22:22595042-22595064 TCACTGTGAGTTGAGTAGCATGG - Intergenic
1181855085 22:25775521-25775543 TTACTGTGAGGTCAGCAGGAGGG - Intronic
1182144131 22:27986596-27986618 ACACTGTGAGGTCAGAGGAGAGG - Intronic
1182182978 22:28371151-28371173 TCACAGTGGGGTCACATGTAAGG + Intronic
1183659051 22:39207695-39207717 TCTCTGGGAGCTCAGCTGCAGGG - Intergenic
1183673594 22:39287580-39287602 GCCCTGTGAAGTCAGAGGCAGGG - Intergenic
1184945946 22:47804251-47804273 TCTCTTTGGGGTCAGATGTAGGG + Intergenic
1185323108 22:50210897-50210919 TCACTCACCGGTCAGATGCATGG - Exonic
949386284 3:3505961-3505983 TCCCTGTGGGCTCAGGTGCATGG + Intergenic
952339874 3:32436635-32436657 TCATTCCAAGGTCAGATGCAGGG + Intronic
952396331 3:32923639-32923661 GAACGGTGAGGTCAGAGGCAAGG - Intergenic
953838121 3:46365654-46365676 ACACTGTGTGGTCACATCCAAGG + Intergenic
954379275 3:50211042-50211064 TCACTGTGTGGCCAGGGGCAGGG - Intronic
954398326 3:50304913-50304935 TCACTGACAGCTCATATGCATGG - Intronic
958894894 3:99818376-99818398 TCAGACTGAGGTCAGAAGCAGGG + Intronic
958986813 3:100789867-100789889 TCACTGAGAGATTAGATGGATGG - Intronic
959184386 3:103027333-103027355 TCACTTTGAATTCAGATCCATGG + Intergenic
959231603 3:103660993-103661015 AATGTGTGAGGTCAGATGCAGGG + Intergenic
959282153 3:104357762-104357784 TTCCTGTGAGGTCAGTTGCTGGG + Intergenic
959877893 3:111407396-111407418 TCACTGGGTGGTTAGATCCAGGG + Intronic
962504083 3:136028252-136028274 GCTCTGTGAGGTCAGAGGTAGGG - Intronic
962823963 3:139081878-139081900 TCACTGTGTTGTCTGATGGAGGG + Intronic
964669569 3:159209987-159210009 TAACTGTGAGGACAGACACAAGG + Intronic
966396807 3:179512173-179512195 TCACTTTGATGTCAGGTGCCTGG - Intergenic
966571519 3:181449375-181449397 TCAGTGTGAGGCCAGGCGCAGGG + Intergenic
967992978 3:195145395-195145417 TCTCTGTGAAGTCACATGAACGG + Intronic
967993015 3:195145599-195145621 TCTCTGTGAAGTCACATGAACGG + Intronic
969917565 4:10505646-10505668 TGAAAGTGAGGTCAGATGAATGG - Intronic
973218099 4:47694497-47694519 TGACTGTGTGGTCAGTTGCCTGG + Intronic
978404016 4:108361038-108361060 TCTCTGTGAAGTCAGCCGCAAGG - Intergenic
980152174 4:129061207-129061229 TTTCTGTGAGGGCAGATGCGCGG + Intronic
981060632 4:140420785-140420807 ACTCTGAGAGGTCAGATGCTGGG + Intronic
982655896 4:158149635-158149657 TCACTATGAGGTCAAATGTTTGG - Intronic
984320624 4:178190940-178190962 TCTCTGTGAAATAAGATGCATGG - Intergenic
985080630 4:186260822-186260844 TCACTGTGTGCTCATATACAGGG + Intergenic
985410847 4:189682261-189682283 TGACTCTGAGGTAAGAAGCACGG - Intergenic
985645036 5:1080768-1080790 TCAGTGTGAGCTCAGAGGCCGGG - Intronic
985705568 5:1399709-1399731 TCACTGGGAGGACAGAGGAAAGG + Intronic
986226440 5:5819424-5819446 TGGCTTTGAGGTCAGATGTATGG + Intergenic
986373200 5:7101713-7101735 AAACTGTGAGGGAAGATGCACGG - Intergenic
987084670 5:14457509-14457531 TCTCTGTGGGCTCAGCTGCAAGG - Intronic
989498012 5:42131858-42131880 TCACTGGGAGGTCTGACGCCAGG + Intergenic
998874347 5:146584157-146584179 TCACTGTCAGGCCAGAAGAAGGG - Intronic
1000926863 5:167204621-167204643 TCACTGTGATGCCAGGGGCAGGG + Intergenic
1000973285 5:167737947-167737969 TCACTCTGAGGTCAAAGGGAAGG + Intronic
1002283390 5:178146475-178146497 TCACCATGAGGTCAGTGGCATGG + Intronic
1003411195 6:5864219-5864241 CCACTGTGAGGTCAGGAGGAAGG + Intergenic
1003976588 6:11350750-11350772 CCACTGTGAGGTCAGCGGCAGGG - Intronic
1004190780 6:13461709-13461731 TCTCTCTGAAGTCAGAGGCAAGG - Intronic
1004624242 6:17359831-17359853 TCACTGTGGGGTAAGGTCCAGGG - Intergenic
1005471530 6:26166243-26166265 CCACTGGGAGGTCAAAGGCAAGG - Intronic
1007015177 6:38458718-38458740 TCACTTTGTGGTCAGAAGCAAGG + Intronic
1008536096 6:52507484-52507506 TGAGTGTGTGGACAGATGCATGG + Intronic
1008640429 6:53456846-53456868 TCAGTGAGAGGTAAGAGGCAGGG - Intergenic
1014030815 6:116701874-116701896 TCATTGTGAAGTCAGATTTAAGG - Intronic
1014473996 6:121850384-121850406 TCACTTTGAGCTGAGATGCCTGG + Intergenic
1014542583 6:122694736-122694758 TCACTGTTAGAGCAGATGGATGG + Intronic
1015400586 6:132783543-132783565 ACGCTGTGAGGACAGCTGCAAGG + Intronic
1015506679 6:133995453-133995475 TCTCAGTGAAGTCAGAAGCAAGG + Intronic
1017159110 6:151348987-151349009 TCACTGTGAAGAAAGATGAAGGG + Exonic
1017165807 6:151407580-151407602 TCAGTGTGTTGTCAGATGCTTGG - Intronic
1019186539 6:170223849-170223871 TCACTGTCAGGTGAGATGCTGGG - Intergenic
1019552542 7:1610368-1610390 GCACTGTGTGGTCAGACTCATGG - Intergenic
1021536266 7:21708331-21708353 TCGCTGTGAGGTTGGATGTAGGG - Intronic
1022663057 7:32384588-32384610 TTGCTGAGAAGTCAGATGCAAGG + Intergenic
1025712001 7:63920459-63920481 TCAGTATGAGGTTAGATGCAGGG - Intergenic
1027178821 7:75923198-75923220 TCACTGTGTTGTCAGAGGGATGG - Intronic
1032334213 7:131009707-131009729 ACATTGTGAGGTCAGATGTATGG + Intergenic
1034476685 7:151288631-151288653 ACACTAAGAGGTCAGATACAGGG + Intergenic
1035375781 7:158405784-158405806 TCAGTGTGCGGCCACATGCATGG - Intronic
1036704259 8:11034863-11034885 TCACTGTGAGGGAACAGGCAAGG - Intronic
1039870451 8:41540940-41540962 TCTCTGTGAGGACATATGGAAGG - Intronic
1040652951 8:49470035-49470057 TAAGTATGAGGTCAGCTGCAGGG - Intergenic
1044207440 8:89507681-89507703 TCACTGTAACCTCAGATGCCTGG - Intergenic
1045015449 8:97997553-97997575 GCTCTGTGAGGTCAGATGACAGG - Intronic
1046683576 8:117199076-117199098 ACACTGAGAGGTCACATGAAGGG - Intergenic
1047188039 8:122653426-122653448 TGACTGTGACCTCAAATGCATGG - Intergenic
1048817781 8:138350097-138350119 TCACTCTGATATCAGATGCCAGG + Intronic
1049386097 8:142343865-142343887 TCACTGTGGAGGAAGATGCAGGG + Intronic
1049859788 8:144890505-144890527 GCACACTGAGGTCAGGTGCAAGG + Intronic
1051748166 9:20315550-20315572 TGACTGTGAGGTGAGAGCCAGGG + Intergenic
1056101323 9:83302960-83302982 TCTTTGTGAGGTCAGATGTTTGG - Intronic
1057086037 9:92211292-92211314 TCTCTGTGTTGTCAGATGTAAGG + Intronic
1058602447 9:106684669-106684691 TCCCTGTGGGGTCAGCTTCATGG - Intergenic
1059446300 9:114340198-114340220 TCACTGTGAGGGCTGGTGCTTGG - Intronic
1059677740 9:116555767-116555789 TCACTCAGCTGTCAGATGCAGGG - Intronic
1060998361 9:127887609-127887631 TCACGATGAGGGCACATGCAGGG + Intronic
1203660742 Un_KI270753v1:39963-39985 TGACTCTGAGGTAAGAAGCACGG + Intergenic
1203671915 Un_KI270755v1:23175-23197 TGACTCTGAGGTAAGAAGCACGG + Intergenic
1185480558 X:443274-443296 TCACTTTGTGGTCAGACGGAGGG - Intergenic
1186140825 X:6571595-6571617 GCTCTGTGAGGTCAGAAACAGGG - Intergenic
1190232388 X:48592326-48592348 GGACTGTGATATCAGATGCAAGG + Intronic
1195859845 X:109371811-109371833 TCACTCTAAGCTCAGATTCAGGG + Intergenic
1196007411 X:110851152-110851174 TCAGGGACAGGTCAGATGCAGGG + Intergenic
1198035766 X:132799991-132800013 TGAAGGTGAGGTGAGATGCAAGG + Intronic
1199803315 X:151272543-151272565 TCTCTGTGAAGTAAGATGCCAGG - Intergenic