ID: 1128558785

View in Genome Browser
Species Human (GRCh38)
Location 15:68650911-68650933
Sequence TCATCTGACCAGAGGGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128558785 Original CRISPR TCATCTGACCAGAGGGCAGC AGG (reversed) Intronic
902514915 1:16984969-16984991 TCATCTCACCAGCGGGCCCCTGG - Intergenic
902662486 1:17914787-17914809 TCATCTGAACTCAGGGAAGCAGG - Intergenic
903304023 1:22400257-22400279 TCACTGGAACAGAGGGCAGCAGG + Intergenic
904885292 1:33733186-33733208 TCCTCTGACCAGAGTGCCTCTGG + Intronic
905772663 1:40648348-40648370 TCATCTGACCCCAGTCCAGCCGG - Intronic
910129389 1:83885669-83885691 TCATCTGGCCCTAGGGCAGTGGG + Intronic
910269679 1:85380496-85380518 TCATGTAACCAGAGGCCAGTGGG - Intronic
910878080 1:91896449-91896471 ACATCTGACCTGAGGGAACCGGG + Intronic
913241513 1:116834254-116834276 TAATCTAACCACAGGGCGGCTGG + Intergenic
914244169 1:145873373-145873395 CCTTCTGACCAGCAGGCAGCTGG + Exonic
915362038 1:155291791-155291813 TCATCTGCCCAGATGGCTTCTGG + Exonic
915755083 1:158251807-158251829 ACATATGCCCTGAGGGCAGCAGG + Intergenic
915824096 1:159057009-159057031 TCATCTAAAAAGAGGGGAGCAGG + Intergenic
916202392 1:162284349-162284371 ACATCTGACCAGCAGGCAGGTGG + Intronic
920920998 1:210297100-210297122 ACATCTGACAAGAGTGCAGAGGG - Intergenic
922878532 1:228960825-228960847 GCCTCTGACCAGAGGGGAGAGGG + Intergenic
923207022 1:231768969-231768991 TCCTGTGTTCAGAGGGCAGCTGG + Intronic
923225017 1:231931154-231931176 TTAGTTGACCAGAGGGGAGCAGG + Intronic
1064005840 10:11698303-11698325 CCAACTGAGCAGAGGGTAGCAGG - Intergenic
1064739565 10:18418737-18418759 TGTTCTGACCACAGGGCATCAGG + Intronic
1065267737 10:23994648-23994670 TCATCCCACCAGGGGGCAGTAGG + Intronic
1065479448 10:26177648-26177670 TCTTCTGGGCAGAGGTCAGCAGG - Intronic
1065688259 10:28307449-28307471 TCATCTGAGCCCAGAGCAGCAGG - Intronic
1067048128 10:42997357-42997379 ACATGTGATCAGAGGGAAGCTGG - Intergenic
1067116143 10:43436948-43436970 CCAGCGGACAAGAGGGCAGCTGG + Intronic
1067416118 10:46104536-46104558 TCTTCTAGCCAGAGGCCAGCAGG + Intergenic
1068789514 10:61011830-61011852 TTATTTGCCCAGAGGTCAGCTGG + Intergenic
1069964812 10:72105634-72105656 TCATGTGAGCAGGGGACAGCAGG - Intronic
1070854340 10:79594613-79594635 TCCCCTGACCTGAAGGCAGCTGG - Intergenic
1073068476 10:100778603-100778625 TCATTTGACCAGTGGGTAGGGGG + Intronic
1073284093 10:102376806-102376828 TCAGCTGATGAGGGGGCAGCTGG + Intronic
1074579363 10:114703783-114703805 TCATCTGAACAGAGCCCAGAAGG + Intergenic
1075610933 10:123854090-123854112 TCATCTGACCTGTGTGTAGCAGG + Intronic
1075906243 10:126084188-126084210 TCAACTGACCAGAGCTCAGTTGG - Intronic
1076379374 10:130014725-130014747 TCATCTGTCCAGACAGCCGCGGG + Intergenic
1076693785 10:132237274-132237296 TGACCTGACCAGAGGCCAGTAGG + Intronic
1078339622 11:10489432-10489454 TGTTGTGGCCAGAGGGCAGCTGG - Intronic
1078669527 11:13352724-13352746 TCATCTAAACAGGAGGCAGCTGG + Intronic
1083202884 11:61131081-61131103 CCCTCTGGCCAGAGGGAAGCGGG - Exonic
1083791538 11:64989296-64989318 GCATCCCACCAGAGGGAAGCTGG - Exonic
1086182195 11:83966203-83966225 TCATCTTTCCAGAGGGAAACAGG - Intronic
1086662829 11:89442930-89442952 TGATTTGAGCAGAGGGCAGCAGG + Intronic
1090662969 11:128894999-128895021 TCATCTGAACAGTTGGCAGGTGG + Intronic
1091814152 12:3423616-3423638 TTACCTGACCAGTGGGCAGGTGG - Intronic
1092389034 12:8059129-8059151 TCATGATAACAGAGGGCAGCAGG + Exonic
1103214893 12:119194407-119194429 ACATCTGGGCAGAGGGCAGAAGG - Exonic
1104631634 12:130407819-130407841 TGATCTGAACAGAGAGAAGCAGG - Exonic
1104892089 12:132144943-132144965 CCATCTCCTCAGAGGGCAGCTGG - Exonic
1105284990 13:18996282-18996304 TCAGAAGACCAGAGGGCAGAAGG + Intergenic
1105302730 13:19150576-19150598 TCTTATCACCAGAGGGCTGCAGG - Intergenic
1105439500 13:20403470-20403492 TCATCTGACCATAGAGCCTCAGG + Intergenic
1106080512 13:26496778-26496800 TCTTCCCTCCAGAGGGCAGCAGG - Intergenic
1106340826 13:28824987-28825009 CCACCTGACCAGAGTGCAGCTGG + Intronic
1106862227 13:33922020-33922042 ACACCTGCCCAGAGGGCTGCTGG + Intronic
1109899577 13:68748303-68748325 TCATCTCAACAGACTGCAGCAGG + Intergenic
1113990698 14:16025126-16025148 GCATCCGAACAGATGGCAGCAGG - Intergenic
1114482462 14:23044265-23044287 TCATTTGGCCAGGGGACAGCAGG - Exonic
1114488552 14:23080437-23080459 TCATCTGGCCAGACAGCAGCAGG - Exonic
1115782559 14:36785906-36785928 TCATGTGACCTGAGACCAGCTGG + Intronic
1116473237 14:45309584-45309606 TCAAATGTCCAGAGGTCAGCAGG - Intergenic
1116657593 14:47672817-47672839 TCAGCTGTTCAGAGGGCACCGGG + Intronic
1119159178 14:72438928-72438950 TGATCTGTCCAGAGGGCAAGAGG - Intronic
1119423508 14:74522036-74522058 TCATCTGACCAGAAGAAGGCAGG + Exonic
1119653615 14:76400859-76400881 TGCTCTGTGCAGAGGGCAGCTGG + Intronic
1119918643 14:78426043-78426065 TCACCTGCCCTGAGGCCAGCAGG + Intronic
1121019319 14:90569457-90569479 TCATCTGACCTGAGGGAGGAGGG + Intronic
1121448339 14:93992539-93992561 TGCTCTGACCAGAGGGAACCAGG - Intergenic
1122122071 14:99560097-99560119 GCATCTATCCAGGGGGCAGCTGG - Intronic
1125523375 15:40360312-40360334 TCCTGAGATCAGAGGGCAGCAGG + Intronic
1125668217 15:41449468-41449490 TGATCTGCCCAGCCGGCAGCAGG + Intronic
1125914718 15:43475590-43475612 ACCTCTGACCAGAGAGCTGCAGG + Exonic
1126169021 15:45679057-45679079 TCAGCTATCCAGAGGACAGCTGG - Intronic
1126450140 15:48798472-48798494 TCACCTGGCCAGAGTGCATCTGG - Intronic
1126516568 15:49545914-49545936 TGATCTCACCAGAAGGGAGCAGG + Intronic
1127386739 15:58473217-58473239 TTATGTGACCAGAGAGAAGCAGG + Intronic
1128289065 15:66462978-66463000 TTCTCTGTCCAGAGGGCAGGAGG + Intronic
1128558785 15:68650911-68650933 TCATCTGACCAGAGGGCAGCAGG - Intronic
1128746737 15:70120067-70120089 TCATCTGATGACAGGGCAGCAGG - Intergenic
1139466734 16:67158061-67158083 TCATGTAAACAGATGGCAGCTGG - Intronic
1139852534 16:69959727-69959749 TCCTCTGACCAGAGGTCCCCAGG + Exonic
1139881505 16:70182635-70182657 TCCTCTGACCAGAGGTCCCCAGG + Exonic
1140371004 16:74412870-74412892 TCCTCTGACCAGAGGTCCCCAGG - Exonic
1140481366 16:75264679-75264701 GCAGATGACCAGAGGGAAGCTGG - Intronic
1141879456 16:86848100-86848122 TCTTCTCACCAGAGTGCAGCTGG + Intergenic
1143080139 17:4375651-4375673 TCATGTGAACATAGGCCAGCTGG + Intergenic
1143080449 17:4377426-4377448 TCATGTGAACATAGGCCAGCTGG - Intergenic
1145823524 17:27858916-27858938 TCATCTGGGTAGAGGGTAGCTGG + Intronic
1148784534 17:50139619-50139641 TCATCAGGGCTGAGGGCAGCTGG - Intronic
1149682678 17:58517137-58517159 ACCTGTGATCAGAGGGCAGCAGG + Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1152696659 17:81800932-81800954 ACATATAAACAGAGGGCAGCTGG - Intergenic
1154201033 18:12301042-12301064 TCATCTGGCCAGTGGTGAGCTGG + Intergenic
1154326189 18:13392488-13392510 TCCTCTGAGCAGAGGGAAGCAGG + Intronic
1155441259 18:25864994-25865016 TCATCTGTTGAGTGGGCAGCTGG - Intergenic
1156062596 18:33098550-33098572 TCATCTCACCAGAGCTCTGCCGG + Intronic
1156892873 18:42209861-42209883 TCAACTGAGCAGAGGGAATCAGG - Intergenic
1157436343 18:47672668-47672690 TAATTTGACTAGAGGGCAGCAGG + Intergenic
1160219241 18:76960531-76960553 TCATCTGAACAAAGGGCTGGAGG - Intronic
1160574772 18:79846959-79846981 TCGTTTGGCCACAGGGCAGCCGG + Intergenic
1160892136 19:1384479-1384501 TTATCTGAGCAGAGGTCCGCAGG - Intronic
1162915197 19:13870952-13870974 TCACCTGACCCCAGTGCAGCTGG - Intronic
1165312026 19:35034218-35034240 TCATCACCACAGAGGGCAGCAGG - Exonic
1166258791 19:41623954-41623976 TCATCTGACCCTGGGGCTGCAGG - Intronic
1167725279 19:51207931-51207953 TCTTCTGGCCAGAGATCAGCAGG + Intergenic
925148488 2:1599077-1599099 TCATCTCACCAGAGGGCACCAGG + Intergenic
925179281 2:1806480-1806502 TCATCCCACCAGAAAGCAGCCGG - Intronic
925962027 2:9026777-9026799 TCATCTGACCAAATTGCAGTGGG + Intergenic
925973078 2:9121301-9121323 TCACCTGACCTGTGGGCAGAAGG - Intergenic
928953791 2:36840246-36840268 TCAACTGATCAGAGGCCAGTGGG + Intergenic
929920552 2:46168359-46168381 TGATCAAACCAGAGGACAGCAGG + Intronic
929924226 2:46195946-46195968 TCATCTGAGCAGGGAACAGCTGG - Intergenic
931441144 2:62291508-62291530 TCATGTGGCCAGAGGTCAGAAGG + Intergenic
931773036 2:65515914-65515936 GCTTATGACCAGAGGGCAACGGG - Intergenic
932285031 2:70524802-70524824 CCAGCTGAGCAGAGGGCACCTGG + Intronic
933654564 2:84877052-84877074 TGTTCTGACCAAAGGGCACCCGG + Intronic
933950188 2:87322643-87322665 TGAGCTGGCCAGAGGGAAGCTGG - Intergenic
934049207 2:88196204-88196226 GCATCCAACCAGAGAGCAGCAGG - Intergenic
935156935 2:100491709-100491731 TGGTCTGACCAGAGGGCAGAGGG + Intergenic
935419488 2:102852766-102852788 TAATCTTGCCAGAGGGCAGTTGG + Intergenic
935581377 2:104758593-104758615 TGATCTGACCACAGTGCAGGTGG - Intergenic
935640603 2:105286409-105286431 TCATCTGAGCAGAGGGCAGGAGG - Intronic
936075189 2:109397259-109397281 AGATCTGCCCAGAGGGCAGCTGG + Intronic
936329999 2:111538954-111538976 TGAGCTGGCCAGAGGGAAGCCGG + Intergenic
936389292 2:112056563-112056585 TCATCTGACCCCAGAGAAGCCGG - Intronic
937156828 2:119725574-119725596 TCACCTGACCCAAGGGCGGCGGG + Intergenic
938665205 2:133527733-133527755 TCATTTGTTGAGAGGGCAGCGGG + Intronic
945637207 2:212370238-212370260 TCACCTCTTCAGAGGGCAGCAGG - Intronic
945673788 2:212832274-212832296 TCAGCTGACTGGAGGACAGCAGG - Intergenic
948685459 2:239666970-239666992 ACATCTGAGCAGAGGGCTGGAGG - Intergenic
948976690 2:241467846-241467868 TCATCTGTCCAGTGGGGAGGTGG + Intronic
1169912622 20:10659663-10659685 TCCTCTGCCCAGAAGGCAGATGG + Intronic
1170134300 20:13055925-13055947 TCATCTGAGCTGAGGGAAGGGGG + Intronic
1171293441 20:23995591-23995613 GCAGCTGCCCAGAGGGAAGCAGG - Intergenic
1172694649 20:36814013-36814035 TGATCTGACCAGAGGTCAGAGGG - Intronic
1173025417 20:39303177-39303199 TGCTCTGACCATTGGGCAGCAGG + Intergenic
1173574927 20:44106678-44106700 ACATCTTACTAGATGGCAGCAGG + Intergenic
1175766843 20:61598176-61598198 TCAGCAGATCAGAGGGCAGTGGG - Intronic
1176120472 20:63452309-63452331 GCCTCTGAGCTGAGGGCAGCAGG + Intronic
1178925788 21:36773814-36773836 TGAACTAAGCAGAGGGCAGCAGG - Intronic
1179572608 21:42286831-42286853 TCGTCTGACCAGAGAGCGGGAGG + Intronic
1179879859 21:44288922-44288944 CCATCTGACCAGGGCACAGCAGG + Intronic
1180316572 22:11282400-11282422 GCATCCGAACAGATGGCAGCAGG + Intergenic
1181501280 22:23316994-23317016 GCAGCTGCCCAGAGGGAAGCAGG + Exonic
1181650872 22:24258424-24258446 GCAGCTGCCCAGAGGGAAGCAGG - Intergenic
1181706509 22:24652315-24652337 GCAGCTGCCCAGAGGGAAGCAGG + Intergenic
1183083076 22:35469636-35469658 TCACCTGAACAGCGGACAGCAGG - Intergenic
1184341877 22:43890780-43890802 TGCTCTTTCCAGAGGGCAGCTGG - Intronic
1184356927 22:43987579-43987601 ACATCTGCCCAGAGAGCACCAGG - Intronic
1184532349 22:45064255-45064277 TCATCTGACGAGTGGGAATCGGG - Intergenic
1184540841 22:45123241-45123263 TTATCTGTCCAGAGGGGAGAAGG + Intergenic
1184780522 22:46646890-46646912 ACATCTTACCAGATAGCAGCAGG + Intronic
949828202 3:8185270-8185292 TCAGGAGACCAGAGGGCAGGAGG + Intergenic
950196845 3:11015436-11015458 ACAGCTGTCCCGAGGGCAGCGGG + Intronic
950398674 3:12753651-12753673 TCCTCTAACCAGGGGGCAGCTGG - Intronic
950447694 3:13047752-13047774 CCATCTGAACAGGGGGCAGTGGG - Intronic
950931837 3:16797697-16797719 TCATCCCACCTGAGGGCAGAAGG + Intergenic
952461014 3:33525999-33526021 TGATCTGACCAGGGGGCGGAAGG + Intronic
954682145 3:52351548-52351570 TGGTCTGACCTGAAGGCAGCTGG + Intronic
955823883 3:62924594-62924616 GCATCTGACCCAGGGGCAGCTGG + Intergenic
960364607 3:116755844-116755866 TGAAATGTCCAGAGGGCAGCTGG + Intronic
961222830 3:125213156-125213178 ACATCTGCCCAGGGGGCTGCGGG - Intergenic
964735561 3:159913688-159913710 ACATCTGCTCAGAAGGCAGCTGG + Intergenic
968006690 3:195247826-195247848 ACATCTCACCATAGTGCAGCAGG + Intronic
968898257 4:3417722-3417744 TCAGCCAGCCAGAGGGCAGCAGG + Intronic
969457476 4:7308366-7308388 TCACCTTTCCAGGGGGCAGCTGG + Intronic
969513309 4:7631934-7631956 GCACCTGCCCAGAAGGCAGCTGG - Intronic
973664834 4:53148566-53148588 TGATCTGACCAGAGGATGGCTGG + Intronic
977864492 4:102008085-102008107 TCATCTGCCCACAGTGCAGATGG + Intronic
980135577 4:128855646-128855668 TCAAGGTACCAGAGGGCAGCTGG + Exonic
980478679 4:133356372-133356394 TCATCAGCCCAGAGGGAAGATGG - Intergenic
980650655 4:135711089-135711111 GCATCTCTTCAGAGGGCAGCAGG - Intergenic
989741071 5:44772766-44772788 TCATCAGACCAGTGGGAATCTGG + Intergenic
991045151 5:62214676-62214698 TCCTGTAACCAGAGGGCTGCTGG - Intergenic
994000366 5:94772420-94772442 CCATCAGAGCAGATGGCAGCTGG - Intronic
994294095 5:98068168-98068190 TCATCTCTTCACAGGGCAGCAGG - Intergenic
995826360 5:116304123-116304145 TCATCTTACCAGAATGCTGCTGG - Intronic
997578048 5:134997795-134997817 TGAGATGCCCAGAGGGCAGCTGG - Intronic
999053394 5:148548297-148548319 ACATCTTCCCAGAGGGCAGCAGG - Intronic
999949496 5:156633809-156633831 TTAACTGACCAAAGAGCAGCAGG - Intronic
1003019164 6:2495436-2495458 GCAGCCAACCAGAGGGCAGCAGG - Intergenic
1005967170 6:30734943-30734965 TCATCTGCTCAGAGGGAAGAAGG + Intronic
1006152820 6:31998389-31998411 CCATCTGAGCCGTGGGCAGCGGG - Intronic
1006159128 6:32031126-32031148 CCATCTGAGCCGTGGGCAGCGGG - Intronic
1006250609 6:32780292-32780314 TCATGTGACAAGAGGGCAAAGGG + Intergenic
1007397897 6:41587725-41587747 TCAGCTGACTACAGGGCCGCTGG + Intronic
1008481729 6:51993125-51993147 ACATCTGACCAGGGTGCAGAAGG + Intronic
1011880873 6:92024406-92024428 TCATCTCTTCAAAGGGCAGCTGG + Intergenic
1016369599 6:143358740-143358762 TCATATGACAAGAAGGCAGAGGG + Intergenic
1017860959 6:158396891-158396913 TAATCTGATGAGAGTGCAGCTGG + Intronic
1018138712 6:160805507-160805529 GCATCTCTCCACAGGGCAGCAGG + Intergenic
1019039237 6:169089844-169089866 TCACCTCTCCACAGGGCAGCAGG - Intergenic
1019699249 7:2465698-2465720 TCCACTGACCAGAGGGTAGATGG - Intergenic
1023058741 7:36310004-36310026 TCATCAGCCCAGAAGGCAGGAGG + Intergenic
1023277481 7:38535491-38535513 TCCACTGACCAGAGGGTGGCGGG + Intronic
1028244364 7:88459152-88459174 TCAGCTAATCAGAGGGCAGCTGG - Intergenic
1028556146 7:92127244-92127266 ACATCTGCCCACAGGGCAGCAGG - Intronic
1029344832 7:99970972-99970994 TCCTCTGACCATAGCGCAGGTGG + Intronic
1033410630 7:141114577-141114599 TCACCTGCCCAAAGGGCAGAAGG - Intronic
1034711011 7:153191535-153191557 TCATCTACCCAGAGGGCAGAGGG - Intergenic
1035232074 7:157471279-157471301 ACCTCAGACCAGAGGGAAGCCGG + Intergenic
1039011325 8:33096557-33096579 CTTTCTGACCAGAGGGCAACTGG - Intergenic
1040398798 8:47026308-47026330 CCATTTGACCTAAGGGCAGCTGG - Intergenic
1040718027 8:50282148-50282170 TTCTCTGGCCAGAGGGGAGCTGG - Intronic
1042577851 8:70240779-70240801 TGATGTGACCAGAGGCCTGCAGG + Intronic
1044303242 8:90609332-90609354 TCATCTCAGCAGAGGGCAAGAGG + Intergenic
1045782197 8:105880064-105880086 TGATCTGATAAGAAGGCAGCTGG + Intergenic
1049622015 8:143602701-143602723 CCATCTGAGCTGAGGACAGCTGG - Exonic
1050242035 9:3646833-3646855 GCATTTGACCACAGGGCAGCAGG + Intergenic
1050277671 9:4016838-4016860 TCATCTGATCATATGCCAGCTGG - Intronic
1051086913 9:13360409-13360431 TCATCTTATCAGATTGCAGCTGG - Intergenic
1051638390 9:19202380-19202402 TGATCTGAACAAAGGGCAGCTGG + Intergenic
1053429646 9:38033642-38033664 TCCTCTGATCAGTGGGCAACAGG + Intronic
1053900866 9:42794300-42794322 TCAGCAGACTAGAGGGCAGGAGG - Intergenic
1056669860 9:88617631-88617653 TGATCTGATCAGAGGGCAAAAGG - Intergenic
1057034684 9:91803157-91803179 TCATCCGACCTGAGGGCACTTGG - Intronic
1057721064 9:97532291-97532313 TCATGGGTCCAGAGGGCAGAGGG - Intronic
1057914646 9:99046575-99046597 GCATCTCATCACAGGGCAGCAGG + Intronic
1059404964 9:114093835-114093857 GCCTCTGGACAGAGGGCAGCTGG - Intronic
1059752418 9:117260278-117260300 TCATGTGAACAGAGGGCAAAAGG + Intronic
1061959626 9:133981446-133981468 GCATCAGAGCAGAGTGCAGCGGG - Intronic
1062401640 9:136375377-136375399 TTCTCTGACAGGAGGGCAGCCGG + Intergenic
1203364878 Un_KI270442v1:248348-248370 GCATCCGAACAGATGGCAGCAGG + Intergenic
1190825912 X:54017813-54017835 TCATCTGAGCTGTGGGCCGCAGG + Exonic
1192492833 X:71591214-71591236 TCAGCTCACCAGACAGCAGCCGG - Intronic
1195880754 X:109590391-109590413 TCATCTGCCCATCAGGCAGCTGG + Intergenic
1200154544 X:153968494-153968516 TCCTCAGACGAGAGAGCAGCTGG - Intronic