ID: 1128560950

View in Genome Browser
Species Human (GRCh38)
Location 15:68667355-68667377
Sequence CCATGTCCTTGCCATGTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128560943_1128560950 24 Left 1128560943 15:68667308-68667330 CCATCCTGCTTCTTCCTCTGCTT 0: 1
1: 0
2: 13
3: 194
4: 1658
Right 1128560950 15:68667355-68667377 CCATGTCCTTGCCATGTTTGAGG 0: 1
1: 0
2: 3
3: 17
4: 215
1128560944_1128560950 20 Left 1128560944 15:68667312-68667334 CCTGCTTCTTCCTCTGCTTTGCC 0: 1
1: 0
2: 6
3: 70
4: 685
Right 1128560950 15:68667355-68667377 CCATGTCCTTGCCATGTTTGAGG 0: 1
1: 0
2: 3
3: 17
4: 215
1128560945_1128560950 10 Left 1128560945 15:68667322-68667344 CCTCTGCTTTGCCAACAGACTCT 0: 1
1: 0
2: 2
3: 20
4: 253
Right 1128560950 15:68667355-68667377 CCATGTCCTTGCCATGTTTGAGG 0: 1
1: 0
2: 3
3: 17
4: 215
1128560946_1128560950 -1 Left 1128560946 15:68667333-68667355 CCAACAGACTCTCCGCTTCCTGC 0: 1
1: 0
2: 1
3: 18
4: 226
Right 1128560950 15:68667355-68667377 CCATGTCCTTGCCATGTTTGAGG 0: 1
1: 0
2: 3
3: 17
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128560950 Original CRISPR CCATGTCCTTGCCATGTTTG AGG Intronic
900086524 1:900603-900625 CCATGACCTTGGCAGTTTTGAGG - Intergenic
900345150 1:2206994-2207016 CCCTGACCTTGCCGTGTTTTCGG - Intronic
904030243 1:27528962-27528984 CCCTGTCCTTGCCAGGTGGGGGG - Intergenic
904886093 1:33739444-33739466 CCAAGAACTTGCCATGTTGGCGG + Intronic
907144401 1:52219377-52219399 CCATGACTTTGCAATGGTTGCGG + Intronic
908456079 1:64306334-64306356 CCACTTCATTGCCATGTCTGTGG - Intergenic
909323516 1:74319987-74320009 CCATTTCCTAGCCATGTGTTGGG + Intronic
909803454 1:79844479-79844501 GCATGTGCTTGGTATGTTTGAGG + Intergenic
909829661 1:80171807-80171829 TCATGTTCTTGGCACGTTTGTGG - Intergenic
910915965 1:92289408-92289430 ACATGTTCTTTCCATGTTTTTGG + Intronic
912516255 1:110218298-110218320 CAATCTGCTTGCTATGTTTGAGG - Intronic
913209625 1:116571568-116571590 CCCTTTCCTTGTCATGTTTGAGG - Intergenic
916568363 1:166003121-166003143 CCATGAGCATGGCATGTTTGTGG + Intergenic
919758287 1:201079704-201079726 CCAGTTCCTTTCAATGTTTGGGG - Intronic
920079448 1:203361768-203361790 CCCTGTCTGTGCCATGATTGAGG + Intergenic
921840126 1:219819538-219819560 CCATGTCCATGCTGTGTGTGTGG - Intronic
922384900 1:225073070-225073092 ACATATCCTTGCCATGTCTGAGG - Intronic
922852056 1:228741195-228741217 GCATGTGCTTGCCAGGTCTGTGG - Intronic
923436755 1:233974697-233974719 TCATGTCACTGACATGTTTGTGG - Intronic
1063971721 10:11385763-11385785 CCCTGTCCCCACCATGTTTGGGG - Intergenic
1064307320 10:14179146-14179168 CCACATCTTTGCCATTTTTGAGG + Intronic
1065967249 10:30780232-30780254 TCAAGTCTTGGCCATGTTTGAGG + Intergenic
1066332887 10:34444070-34444092 CCATGTTTTTTCCATGTTTTAGG - Intronic
1067956145 10:50793908-50793930 AGAAGCCCTTGCCATGTTTGAGG + Intronic
1069459215 10:68578586-68578608 ATCTGTCCTTGCCATGGTTGGGG - Intronic
1071075994 10:81753668-81753690 CCATGTTCTTTCCACGTTTCAGG - Intergenic
1071333224 10:84581899-84581921 TCATGTACTTACCATTTTTGTGG - Intergenic
1071789811 10:88941830-88941852 CAATGTCCCAGCCATGTATGTGG - Exonic
1072262531 10:93694142-93694164 CAAAGTCCTTCCCATGTTTAAGG - Intronic
1074060270 10:109959157-109959179 CTACGTCCTTGCCATCTTTTGGG - Intergenic
1075568986 10:123525318-123525340 CCAAGTCCTTGCCATGTGCCAGG - Intergenic
1075680742 10:124329486-124329508 CCAGTTCCCTCCCATGTTTGAGG + Intergenic
1076295716 10:129382693-129382715 GCATGTCCTTCCCATTTTTGGGG - Intergenic
1078054687 11:7998443-7998465 CCATGTCTTTTGCATTTTTGTGG - Exonic
1078297312 11:10086243-10086265 ATATGTCCTGGCCATGTTTTTGG + Intronic
1078425531 11:11247607-11247629 CAATATCCTTACCATTTTTGAGG + Intergenic
1078877318 11:15411570-15411592 CCTGGTCCTTCCCATCTTTGTGG - Intergenic
1079955181 11:26853242-26853264 CCATGTCCTAACCACGTTTGTGG - Intergenic
1080394757 11:31879807-31879829 CTCTGACCATGCCATGTTTGTGG + Intronic
1081580614 11:44349044-44349066 CCAAGGCCCTGCCATCTTTGAGG + Intergenic
1082906995 11:58319155-58319177 CCATGTCTTTGCATTATTTGTGG + Intergenic
1083488317 11:62997071-62997093 CCAGGCCCTTGCCATGGTTTTGG - Intronic
1083975408 11:66115477-66115499 CCATCTCCTTGCCCTGTATATGG + Intronic
1085161741 11:74354038-74354060 CCTTCTCCTTGCCTTGTCTGTGG + Intronic
1088895954 11:114078554-114078576 TGATGTCCTTGTAATGTTTGCGG + Intronic
1091173849 11:133542360-133542382 CCTTGTCCCTGGCATCTTTGGGG + Intergenic
1099199985 12:79664532-79664554 CCATGTCATTATCTTGTTTGGGG + Intronic
1100139217 12:91596098-91596120 CCATGTCCTCCCAATATTTGGGG - Intergenic
1100526859 12:95427622-95427644 ACATATCCTTGGTATGTTTGAGG - Intergenic
1102257742 12:111425819-111425841 CCCTGTCCTTGCCCTGCCTGGGG - Intronic
1102833358 12:116028696-116028718 CTTTGACCTTGCCATGTTTTTGG - Intronic
1102966027 12:117126311-117126333 GCATGTCCTTAACATGTTTTAGG + Intergenic
1105559946 13:21480875-21480897 CCATGTCCCTGCACTGTTGGAGG - Intergenic
1105979051 13:25500014-25500036 CCATGGGGTTGTCATGTTTGGGG - Intronic
1106208956 13:27623172-27623194 ACATGTGCTTGACAAGTTTGAGG + Exonic
1106387084 13:29297735-29297757 CCCTGTCCTAAACATGTTTGAGG + Intronic
1106532367 13:30605118-30605140 GCATGTGCTTGCTTTGTTTGGGG + Intronic
1107002622 13:35567469-35567491 CCATTTTCTTGCCATCTTTTGGG - Intronic
1108329302 13:49369396-49369418 CCATGTCGTTGCCATGTATTAGG - Intronic
1110534878 13:76639462-76639484 GCATGTTCTTGGCATGTTAGTGG - Intergenic
1111242535 13:85494362-85494384 CCTTTACCTTGCTATGTTTGGGG - Intergenic
1111296594 13:86287163-86287185 GCATGTCCTCCCCATGTCTGTGG - Intergenic
1112229619 13:97575471-97575493 CCATTTCCTTGCAATGTTTATGG + Intergenic
1114148223 14:20003666-20003688 CAATGTTCTGGGCATGTTTGAGG + Intergenic
1114740669 14:25093922-25093944 CCATTTCAGTGCCATGTTTGTGG - Intergenic
1117435687 14:55713303-55713325 CCATGTCATTCCCATTTTTCTGG - Intergenic
1120808798 14:88781601-88781623 CCAGGTCCCTCCCATGTCTGGGG - Intronic
1121829795 14:97040676-97040698 CTATGTATTTGCCATTTTTGAGG + Intergenic
1122839220 14:104446780-104446802 CCATGTCCTGGCCTTGCTTTGGG - Intergenic
1123020416 14:105395404-105395426 CCCTGTGCTTGCTAAGTTTGGGG - Exonic
1125003243 15:34793290-34793312 CAATGTCCCTGCCATGTACGTGG - Exonic
1127295825 15:57607846-57607868 CCATGTCCTGGCCAGGTTCCTGG + Intronic
1127792521 15:62410964-62410986 CCATGTGCTTGCTGTGGTTGTGG + Intronic
1128560950 15:68667355-68667377 CCATGTCCTTGCCATGTTTGAGG + Intronic
1129010194 15:72409055-72409077 CCATTTCATTGCCAGCTTTGGGG - Intergenic
1129742770 15:77997947-77997969 CCATTTCCGTGCCATGCTTTTGG - Exonic
1137614991 16:49841132-49841154 CCACGTCCTTGCCATGTTATTGG - Intronic
1138081319 16:54093815-54093837 CCATGTCCTTGCCACGTGCCTGG - Intronic
1140152009 16:72377177-72377199 CCATGTCCTTTGCAGGGTTGTGG + Intergenic
1140402441 16:74682685-74682707 CCATGCGCTTGCCAAGTGTGAGG + Exonic
1140913087 16:79471067-79471089 CCAGGTCCATGCCATCTTTTAGG + Intergenic
1141249432 16:82341697-82341719 CCAAGTTATTGCCATGTCTGTGG + Intergenic
1142362990 16:89636056-89636078 CCTTGTGCTTGCCCTGTGTGGGG + Intronic
1144820073 17:18066544-18066566 CAAAGCCCTAGCCATGTTTGTGG - Exonic
1146526640 17:33572499-33572521 CCCTTTCCTTGCCATGCTTGGGG - Intronic
1148937811 17:51178028-51178050 CCTTTTCCTTGCCGTGTATGAGG - Exonic
1149653348 17:58292900-58292922 CTATGTCTTTGCCAAATTTGGGG - Intergenic
1151666336 17:75547147-75547169 CGATGTCCTTGCTCTCTTTGAGG - Intronic
1152460674 17:80440685-80440707 CCATGTCCTTCCCACGATGGCGG + Intergenic
1153672896 18:7429459-7429481 CCATAACCTTCCGATGTTTGGGG + Intergenic
1153762763 18:8347822-8347844 CCAAATCCTTACCAGGTTTGTGG + Intronic
1155331093 18:24716920-24716942 CCATGTGTATGCCATCTTTGGGG + Intergenic
1161185025 19:2911933-2911955 CAATGTCCCTGCCATATATGAGG + Intronic
1161514137 19:4687297-4687319 CCCTGTCTCTGCCATGTTGGTGG - Intronic
1163201800 19:15774999-15775021 TCATCTCTTGGCCATGTTTGTGG - Intergenic
1164040598 19:21489413-21489435 CCATGTCCCTGGCATATTTTGGG + Intronic
1164305022 19:23998446-23998468 CTTTCACCTTGCCATGTTTGAGG - Intergenic
1164386263 19:27773196-27773218 CTCTTGCCTTGCCATGTTTGAGG + Intergenic
1164386309 19:27773513-27773535 CTCTTTCCTTGCCATGTCTGAGG + Intergenic
1166118494 19:40670343-40670365 CCATGTCCTTGCCATGCACGTGG - Intronic
1166696016 19:44851764-44851786 CCATGTCCTGGCCAAGTTCATGG + Intronic
1167294769 19:48643506-48643528 GCATGTCCTAGCTATTTTTGAGG + Intronic
1168210523 19:54886754-54886776 CCATGACCTTGTCAGTTTTGAGG + Intronic
1168338778 19:55611996-55612018 CCATGTCCTTGCCCTTAGTGGGG - Intronic
1168556058 19:57340883-57340905 CCTTGCCATTGCCATTTTTGGGG + Intergenic
925185383 2:1843135-1843157 CGATGTCCCTGCCTTGTCTGTGG + Intronic
927939126 2:27092775-27092797 CCTTATCCTGGCCATGCTTGAGG + Intronic
929214686 2:39399481-39399503 CCATCTCATTTCCATCTTTGAGG + Intronic
929289774 2:40176649-40176671 CCACGTTCATCCCATGTTTGTGG - Intronic
929304130 2:40340619-40340641 CCATGCCCTTCCCAGGTTTAGGG + Intronic
932759940 2:74432660-74432682 CCGTGTCCTAGCCAGGGTTGGGG + Exonic
932812756 2:74837971-74837993 GCCTGCCCTTGCCATTTTTGTGG + Intronic
934601955 2:95664423-95664445 CCATGTCCTTGCCACTCTGGTGG + Intergenic
936535314 2:113306578-113306600 CCATGTCCTTGCCACTCTGGTGG + Intergenic
937748684 2:125447324-125447346 TCTTGACTTTGCCATGTTTGTGG - Intergenic
938954950 2:136288710-136288732 CCCTGTCCTTGCCATCATTGTGG + Intergenic
940755641 2:157678968-157678990 CCTTATGCTTGCCCTGTTTGGGG - Intergenic
941348971 2:164407973-164407995 CAATGACCTTGACAGGTTTGAGG - Intergenic
942462307 2:176176887-176176909 CCAAGCCCTTACCATCTTTGAGG + Intergenic
942715310 2:178884834-178884856 CCATGTCCTTGCTTTCTGTGGGG - Intronic
944535324 2:200704034-200704056 CCAAGTCCTTCCCATCTTTATGG - Intergenic
944996254 2:205297555-205297577 CCATGTCTTTCATATGTTTGAGG - Intronic
946188829 2:217996510-217996532 CCATGCCCTAGCCATGTTCTTGG + Intronic
946884174 2:224206574-224206596 CCATCTCCTTGCCATGTCTGGGG + Intergenic
947836918 2:233182444-233182466 CCCTGTCTTTGCCACATTTGAGG + Exonic
948463403 2:238140922-238140944 CTACTTCCATGCCATGTTTGCGG + Exonic
948864504 2:240768472-240768494 CCATGTCCTGGCCATCTTTGGGG + Intronic
1169299894 20:4432839-4432861 CCCTGTCCTTGCCATCCTTGGGG - Intergenic
1169622319 20:7521259-7521281 CCAAGTCCTTGCAGTGCTTGGGG + Intergenic
1169627939 20:7593844-7593866 CTATGTCCTGGTCATATTTGAGG + Intergenic
1171066528 20:22021736-22021758 CCATTTCCTTGCTTTCTTTGTGG - Intergenic
1174388989 20:50205724-50205746 ACATGACCTTGACATGTTCGAGG - Intergenic
1174619646 20:51864343-51864365 ACAGGTCCTGGCCAGGTTTGGGG + Intergenic
1174741903 20:53022653-53022675 CCATGTGCTTGGCATTTTTATGG - Intronic
1175913542 20:62415566-62415588 CCCTGCCCTTACCATGTCTGGGG + Exonic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1177870314 21:26564445-26564467 CCAGGTACTTGCTATGTTTGGGG - Intronic
1179615189 21:42579112-42579134 CCGTGCCCTTCACATGTTTGAGG - Intronic
1179992206 21:44953925-44953947 TCATGACCATGCCATGTATGGGG + Intronic
1180751393 22:18126896-18126918 CCATGTACTTGCCATGTCTCGGG - Exonic
1181170822 22:21008895-21008917 CCATGTACTTGCCATGGTGAGGG + Intergenic
1182361551 22:29749433-29749455 CCATGTGCCTGGCATGTGTGAGG - Intronic
1185427770 22:50783272-50783294 CCGTGTCCTTGCCATCTAAGTGG + Intronic
949880630 3:8657989-8658011 CCCTGTTCTTCCCATGTGTGGGG + Intronic
950897577 3:16467516-16467538 GCATGTGCTTGGCATGTTTGAGG - Intronic
952012934 3:28922063-28922085 CCATGTCCTTGTCTTTTATGTGG + Intergenic
953020366 3:39109204-39109226 CCAAGTCCTTACCTTCTTTGAGG - Exonic
953737925 3:45512185-45512207 CCATGTACTGGTGATGTTTGTGG + Intronic
955949990 3:64233465-64233487 ACATGTGCCTGGCATGTTTGAGG - Intronic
957162288 3:76625675-76625697 CAATATGCTTGACATGTTTGAGG + Intronic
959180834 3:102978493-102978515 CCATGTCCTTTTCAGGGTTGTGG + Intergenic
963719244 3:148840990-148841012 CCATGACCTTGCCATGTCTGAGG + Intronic
963812721 3:149794964-149794986 TCATGTCCTTAAAATGTTTGTGG - Intronic
964374951 3:156040962-156040984 CCAGGTGCTTGCCATCTTTTGGG + Intronic
967972076 3:195006390-195006412 ACTGGTCCTTGCCATGCTTGGGG - Intergenic
968747965 4:2370718-2370740 CCATGGCCTTGCCACGTCCGGGG - Intronic
972098237 4:35377202-35377224 CCATATCCTTATCATTTTTGTGG - Intergenic
972366788 4:38383404-38383426 CAATGACCTTGCCAGGTTAGTGG + Intergenic
974208204 4:58735141-58735163 ACATTTCCTTGCCAAGTTTTGGG - Intergenic
979977127 4:127210610-127210632 CCATGTCCTAAGCATGTGTGTGG - Intergenic
981196660 4:141929106-141929128 CCATGAATTTGCCATGTGTGGGG + Intergenic
982485777 4:155964239-155964261 CCAAGCCATTGCGATGTTTGTGG - Intergenic
984126662 4:175818542-175818564 CCATGTGCTTGTCTTGTGTGAGG - Intronic
984934186 4:184875749-184875771 CCATGTCTTTGCCAGGTCTAGGG + Intergenic
987685399 5:21193121-21193143 CCAGGTCCTGTCCAGGTTTGGGG - Intergenic
988370530 5:30362530-30362552 CCATGTACTTGAGCTGTTTGGGG + Intergenic
992648691 5:78836233-78836255 CCATGGGATTGCCATGTGTGAGG + Intronic
993089067 5:83401168-83401190 CCAGGTCCTTCTTATGTTTGAGG + Intergenic
993680364 5:90870548-90870570 CCTTGTTCTTGCCAAATTTGAGG - Intronic
996205479 5:120729955-120729977 CCATTTCCTTGGCATTTTTGAGG - Intergenic
996454488 5:123664395-123664417 CATTGTCCTTGCCATGGATGAGG + Intergenic
997186001 5:131882800-131882822 GAATGTGCTTGGCATGTTTGAGG - Intronic
999639327 5:153655900-153655922 TCAAGTCCTTTCCAGGTTTGGGG + Intronic
1001050953 5:168414095-168414117 CAATGTCCTTGCCCTGTTCCTGG - Intronic
1001094633 5:168766687-168766709 CCTGGTCCCTGCCATGTTAGGGG + Intronic
1002025061 5:176391220-176391242 CCATGTCCTTGTCTTGTATCTGG - Intronic
1003715437 6:8640940-8640962 CCTTGTCCTTGCCATTTTAATGG + Intergenic
1003726362 6:8770016-8770038 ACATGTTCTTGTCATATTTGGGG + Intergenic
1004189448 6:13451259-13451281 CAAAGCCCTTCCCATGTTTGGGG - Intronic
1008112807 6:47511331-47511353 TCATGACCTTGACATTTTTGAGG - Intronic
1013665116 6:112339859-112339881 CCATGTCCCTACAATATTTGGGG - Intergenic
1013995006 6:116297773-116297795 GCATCTCTTTGCCATGTTAGGGG + Intronic
1016535185 6:145102197-145102219 TCATTTCAATGCCATGTTTGGGG + Intergenic
1016813810 6:148285352-148285374 CTATCTCCTTGCTATGGTTGTGG + Intronic
1018480488 6:164184567-164184589 TCCTGCCCTTGCCCTGTTTGGGG + Intergenic
1018987184 6:168646827-168646849 CCAAGTCCTTGACATCTGTGAGG - Intronic
1020058529 7:5135300-5135322 CCAAGTCTTAGCCATGATTGTGG + Intergenic
1022645782 7:32227510-32227532 CCATGTTCTAGCCATGTGTTAGG - Intronic
1023004709 7:35851164-35851186 CCATGTCCTTCTTATCTTTGAGG - Intronic
1023572330 7:41585026-41585048 CCATGTCTTTGCCTTCTCTGAGG + Intergenic
1024275298 7:47672257-47672279 CCACGTTCTAGCAATGTTTGAGG + Intergenic
1027789798 7:82625276-82625298 TGATGTCCTTCCCATTTTTGAGG + Intergenic
1028431526 7:90752368-90752390 CCATGTAATTGCAAAGTTTGGGG - Intronic
1029682670 7:102122695-102122717 ACATTTCCTAGCCATGTCTGGGG - Intronic
1032647409 7:133840789-133840811 TCATTTCCTTACCAAGTTTGTGG + Intronic
1033635118 7:143205004-143205026 GGAAGTCCCTGCCATGTTTGGGG + Intergenic
1037197718 8:16212349-16212371 ACATGATCTTGCCATGTTTCAGG + Intronic
1037325041 8:17680604-17680626 CTAGGAGCTTGCCATGTTTGTGG + Intronic
1038218865 8:25588605-25588627 CCATTTCCTTGCCATCTCTTTGG + Intergenic
1039089976 8:33817385-33817407 CTTTGTCCTAGCCATTTTTGTGG + Intergenic
1040776380 8:51048381-51048403 CCATGTACTTCCCCTGTTTGGGG - Intergenic
1041045590 8:53882988-53883010 AAATGTCCTTGTCAAGTTTGGGG - Intronic
1042519502 8:69696287-69696309 CTATCTACTTGCCATTTTTGTGG - Intronic
1042632988 8:70841631-70841653 TCATATCCTTGACATGTTTTAGG + Intergenic
1047391015 8:124451318-124451340 CCATGCCGTTGCCATGATCGGGG - Exonic
1048729530 8:137422824-137422846 CCTTATTCTTGCCATTTTTGGGG - Intergenic
1048820472 8:138375851-138375873 CCATCTCCTTGCCCTGTTACTGG - Intronic
1050264784 9:3878796-3878818 CCATCTCCTTCCCCTTTTTGTGG - Intronic
1055319612 9:75069482-75069504 CCATGGGCTTGCTTTGTTTGAGG + Intronic
1058838901 9:108886356-108886378 TCGTGTCTTTGCCATGTTTTGGG - Intronic
1059360021 9:113734957-113734979 GCATGTCCTTTCCGTGTTGGAGG - Intergenic
1059375776 9:113880218-113880240 CCATGTTCTTGTGATGTTTTGGG + Intronic
1059943867 9:119385878-119385900 CCATTTCCATGCCATTTTTTAGG + Intergenic
1060054621 9:120402916-120402938 CCATGTCCTGGGCCTGATTGAGG - Exonic
1061355489 9:130101663-130101685 CTAAATCCTTACCATGTTTGGGG + Intronic
1061423032 9:130482385-130482407 GCATGCCCTTGCCATGCCTGTGG + Intronic
1061879631 9:133562341-133562363 CCATGGCTATGCCCTGTTTGGGG - Intronic
1186556987 X:10570202-10570224 TGATGTGCTTGGCATGTTTGAGG - Intronic
1186696759 X:12042756-12042778 CCATGTCCTTGTGAAATTTGTGG + Intergenic
1187584355 X:20643472-20643494 CCATGTCCTAGGCATGTATTAGG - Intergenic
1190373083 X:49761936-49761958 CCATGACCTTGACATTTTAGTGG + Intergenic
1191061370 X:56300441-56300463 AATTGTCCTTGCCAGGTTTGAGG + Intergenic
1191062565 X:56315050-56315072 AATTGTCCTTGCCAGGTTTGAGG - Intergenic
1193725309 X:85031713-85031735 GAATGTGCTTGACATGTTTGGGG + Intronic
1193759470 X:85446318-85446340 CTCTGTTCTTGCCATGTTTTGGG + Intergenic
1194196372 X:90898264-90898286 GTATGTCCTTGGCATATTTGTGG + Intergenic
1194255933 X:91633631-91633653 CCATGGCCTTTCCATGTCTAAGG - Intergenic
1197366321 X:125568070-125568092 CCATCTCACTGCCATGTTCGTGG + Intergenic
1197955760 X:131945840-131945862 TCAAGTCCTTGCCATCTTTCTGG - Intergenic
1198663148 X:138993110-138993132 TCATGACCTTGACATTTTTGAGG - Intronic
1198949821 X:142057991-142058013 CTCTCTCCTTGCCATGTCTGAGG - Intergenic
1200337866 X:155368993-155369015 CAAGGTCCTTGCATTGTTTGCGG + Intergenic
1200348604 X:155472233-155472255 CAAGGTCCTTGCATTGTTTGCGG - Intergenic
1200447651 Y:3284970-3284992 CCATGTCCTTTCCTGGTTTTTGG + Intergenic
1200542215 Y:4472463-4472485 GTATGTCCTTGGCATATTTGTGG + Intergenic
1200574662 Y:4872901-4872923 CCATGGCCTTTCCATGTCTAAGG - Intergenic