ID: 1128562089

View in Genome Browser
Species Human (GRCh38)
Location 15:68675398-68675420
Sequence AGGGAAAGTAAAGCCTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 268}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128562081_1128562089 13 Left 1128562081 15:68675362-68675384 CCTTTGGAGCTGTCTCTTCCTCT 0: 1
1: 0
2: 2
3: 38
4: 400
Right 1128562089 15:68675398-68675420 AGGGAAAGTAAAGCCTCTGAGGG 0: 1
1: 0
2: 0
3: 21
4: 268
1128562084_1128562089 -5 Left 1128562084 15:68675380-68675402 CCTCTAGCTCACCTTCCCAGGGA 0: 1
1: 0
2: 2
3: 25
4: 253
Right 1128562089 15:68675398-68675420 AGGGAAAGTAAAGCCTCTGAGGG 0: 1
1: 0
2: 0
3: 21
4: 268
1128562080_1128562089 25 Left 1128562080 15:68675350-68675372 CCTCTGCTTGGGCCTTTGGAGCT 0: 1
1: 0
2: 0
3: 15
4: 159
Right 1128562089 15:68675398-68675420 AGGGAAAGTAAAGCCTCTGAGGG 0: 1
1: 0
2: 0
3: 21
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128562089 Original CRISPR AGGGAAAGTAAAGCCTCTGA GGG Intronic
901240680 1:7691370-7691392 AAGGAGAGGAAAGCCACTGAGGG + Intronic
901917254 1:12509148-12509170 AGGGAAAGTAAATCCTCATGAGG + Exonic
901963175 1:12843673-12843695 AGGGACAGTGCAGCCTATGATGG - Intergenic
902109803 1:14068654-14068676 AGGGCAATGAAAGCCCCTGAAGG - Intergenic
902383657 1:16064465-16064487 AGGGAGAGCAGAGCCTCTGGGGG - Intronic
902442542 1:16440543-16440565 AGGGAAGGAGAAGCCTCTGGAGG + Intergenic
904300236 1:29549441-29549463 AGGGAAGGAGAAGCCACTGAAGG - Intergenic
904457999 1:30658674-30658696 AGGGAAGGAGAAGCCACTGAAGG + Intergenic
905285718 1:36879031-36879053 AGGGAGAGAAGAGCCACTGAGGG - Intronic
906238149 1:44224255-44224277 AGGGCAAGGAGAGCCACTGAAGG - Intronic
906258737 1:44369944-44369966 AGAGAAAGCAAGGCCTCTGTAGG - Intergenic
907764782 1:57398354-57398376 AGGGAAAGGAGAGCAACTGATGG + Intronic
908317715 1:62949605-62949627 GAGGAAACTAAAGCCTCAGAAGG - Intergenic
908722294 1:67138558-67138580 AGGGAATGTCAAGCCTAGGAAGG - Intronic
909895128 1:81059118-81059140 GGGGACAGTAAAACCTTTGAGGG - Intergenic
912313246 1:108644070-108644092 AGTGAAAGCAAAGGCTCTGATGG + Intronic
912505387 1:110152235-110152257 AGTGGAGCTAAAGCCTCTGACGG - Intronic
917214246 1:172661455-172661477 TAGAAAAGTAAAGCCTCTGGAGG + Intronic
918247339 1:182671525-182671547 AGAGAAACTAGAGCCTCCGAGGG + Intronic
919048930 1:192488309-192488331 AAGGAAAATAAAGCCCCTGATGG - Intergenic
921173180 1:212566863-212566885 TGGGAAAGTAAAACCTCGTACGG + Intronic
921554339 1:216579422-216579444 TGGGAAAGTATATACTCTGAGGG + Intronic
922350318 1:224729856-224729878 AGGGACAGTGTAGCCTCTGGGGG - Intronic
923124419 1:231022851-231022873 AGGCAACATTAAGCCTCTGAGGG - Intronic
923484310 1:234414452-234414474 AGGGAAAGAAAAGCCTGGAAAGG + Intronic
923611489 1:235499567-235499589 AGGGAAAGTTTTCCCTCTGAAGG + Intronic
923638513 1:235725652-235725674 AGGGAAAGCAGAGTCTCTGGAGG + Intronic
924205474 1:241707296-241707318 AGGGGCAGCAAAGCCTATGAAGG - Intronic
924471530 1:244346940-244346962 AGAGACAGGAAAGTCTCTGAAGG - Intergenic
1063607621 10:7536656-7536678 AGGGAAAGGCAAGGCTTTGAGGG - Intergenic
1064375136 10:14788679-14788701 AGGGAAATAGGAGCCTCTGAAGG - Intergenic
1064892386 10:20191964-20191986 AGTGACAGTAAAGCCTTTCATGG - Intronic
1068057584 10:52030069-52030091 TGGGCAAATGAAGCCTCTGATGG - Intronic
1068803214 10:61164845-61164867 TGGCAAAGTGAAGGCTCTGATGG - Intergenic
1069234952 10:66059440-66059462 AGGGAAAGTAAAGATTTTCAAGG - Intronic
1070202830 10:74224111-74224133 AGGGAAAGAAAAGCTTTGGAGGG - Intronic
1070646352 10:78204719-78204741 AGGGAGAGAAAGGCCTCTGGAGG - Intergenic
1070718173 10:78737642-78737664 AGGCAAAGGGGAGCCTCTGAAGG + Intergenic
1070797651 10:79226205-79226227 GGGGAAAATAGAGGCTCTGAGGG + Intronic
1072097988 10:92201188-92201210 AGGGAAAGCAATGACTATGACGG + Intronic
1072683433 10:97522913-97522935 AGGGAGATGAAAGCCTCTAAAGG - Intronic
1072684094 10:97527362-97527384 AGGGATGGGAGAGCCTCTGAAGG - Intronic
1073215107 10:101831953-101831975 AGGAAAAATGAAGCCTCTGTGGG - Intronic
1073850749 10:107615007-107615029 ATGAAAAGTAAAGCCTTTAATGG + Intergenic
1074806822 10:117062064-117062086 AGGGAAAGTAATTCTTCTGGAGG - Intronic
1076512204 10:131020935-131020957 CGGGAAAGAAAAGTCTCTCAGGG - Intergenic
1076743370 10:132499385-132499407 GGGGCAAGTAAGGCCTCTGAGGG - Intergenic
1077128288 11:955053-955075 AGGGAAAGAAACCACTCTGAGGG - Intronic
1080267825 11:30420104-30420126 GGGGAAATTAAAGTCACTGATGG + Intronic
1082004012 11:47409824-47409846 AGGGAAAGTTTAGCCTCAGGCGG + Intronic
1082992244 11:59217412-59217434 GTGGAAAGAAGAGCCTCTGAGGG - Intergenic
1085646821 11:78229386-78229408 AGGGAACGGGGAGCCTCTGAAGG + Intronic
1088009722 11:104985679-104985701 AGGGAGAGTACAGCATCTGAGGG + Intergenic
1088336768 11:108713999-108714021 AATGAAAGTCAAGCCTCTTAGGG - Intronic
1088753896 11:112869136-112869158 AGGGAAAGTAAACTTTCTCAAGG - Intergenic
1090342126 11:126033252-126033274 AGGGAATGGAGAGCGTCTGAAGG + Intronic
1091149341 11:133312667-133312689 AGGGAAAGTAAAGCTTGGGTTGG - Intronic
1091887440 12:4026972-4026994 AGAGAAAGTAGGGTCTCTGAGGG - Intergenic
1092634701 12:10430588-10430610 AGAAAAAAAAAAGCCTCTGATGG - Exonic
1092831204 12:12446168-12446190 ATGGAATGTAAGGTCTCTGAAGG - Intronic
1093607116 12:21105580-21105602 AGAGAAAGTGAAGGCCCTGAAGG - Intronic
1095768308 12:45921809-45921831 AGGGAAAGTAAAGGGTTTAAAGG - Exonic
1096237571 12:49940079-49940101 GGGGACATTAAACCCTCTGATGG + Intergenic
1098554926 12:71807786-71807808 AGGGAGAGACAATCCTCTGATGG + Intergenic
1098614940 12:72510186-72510208 AGGGAAAGCAAAGTCTAAGAAGG - Intronic
1099432898 12:82609366-82609388 TGGGAAAGTCAAGCCTCTCTAGG + Intergenic
1100926386 12:99553142-99553164 ATGTAAAATAAAGCCTCTGTAGG + Intronic
1102046987 12:109835575-109835597 TGGGAAAGAGAACCCTCTGAGGG + Intergenic
1102846179 12:116185992-116186014 AGAGAAAGAAAAGCATATGATGG - Intronic
1105948007 13:25206090-25206112 AGCCAAAGCAAAGGCTCTGAAGG + Intergenic
1106033037 13:26019641-26019663 TGGGAAGGGAAAGCCTCTGAGGG - Intronic
1106484123 13:30157671-30157693 AGCAAAAGTAAATCCTCTGCAGG - Intergenic
1106804548 13:33292750-33292772 AGGGAAAGTAATTTCTGTGAGGG + Intronic
1107824330 13:44313868-44313890 AGGCACAGGAAAGCCACTGAGGG + Intergenic
1109331950 13:60941508-60941530 AAGGGAAGAAAAGCCTCAGATGG + Intergenic
1113352753 13:109545415-109545437 AGAGAAAGAAAAGTCTCTCAGGG - Intergenic
1114818767 14:25991295-25991317 AGAGAAAGTATAGGCTCTGACGG + Intergenic
1115371246 14:32617114-32617136 AGGCAATGGAAAGCCACTGAAGG - Intronic
1118444611 14:65839973-65839995 AAGAAAAGGAAATCCTCTGATGG - Intergenic
1119223201 14:72925704-72925726 AGGAAAACGGAAGCCTCTGATGG - Intergenic
1120234422 14:81874713-81874735 AGGGAAAGAAAAACTTGTGAAGG + Intergenic
1120244555 14:81991703-81991725 ATGAAAAACAAAGCCTCTGAAGG + Intergenic
1121105300 14:91275361-91275383 AGGGAAAGGAAAGCATCATAAGG + Intronic
1121810776 14:96887614-96887636 AGTGAAAGTAGAGCCACTGAAGG + Intronic
1202845650 14_GL000009v2_random:171424-171446 GGGGAAGGGAAAGCCTCTAAGGG - Intergenic
1125339859 15:38664121-38664143 AGGGAAAGAAATGTCACTGAAGG + Intergenic
1126496405 15:49295564-49295586 AGGTAATGGTAAGCCTCTGAAGG - Intronic
1126528758 15:49688791-49688813 TGGGAAAGTAAAGACTCTTGGGG - Intergenic
1127028313 15:54833152-54833174 AGGGAAAGGAAAGGATGTGAGGG - Intergenic
1127551178 15:60039810-60039832 AGGGAAAGTAAAGACCATGGTGG - Intronic
1128562089 15:68675398-68675420 AGGGAAAGTAAAGCCTCTGAGGG + Intronic
1129170224 15:73803046-73803068 AGGCCCAGTGAAGCCTCTGATGG + Intergenic
1130787612 15:87117504-87117526 AGGCAATGAAAAGCCACTGAAGG + Intergenic
1130970039 15:88725212-88725234 AGGGAGAGCAAGGTCTCTGAGGG + Intergenic
1131062599 15:89413120-89413142 AGGGAAAATAAAGCCGCCGGGGG - Intergenic
1131216288 15:90538441-90538463 AGGGAAGTTAAAGCCACTGAAGG + Intronic
1132187590 15:99815364-99815386 AGGGAAAGGAAAGTTACTGATGG + Intergenic
1135265818 16:21024567-21024589 AGGGGAAGGAAAGGGTCTGAGGG + Intronic
1137537009 16:49334816-49334838 AGGGAAAACAATGCCTCAGAAGG - Intergenic
1137692750 16:50440951-50440973 AGGTAAAGTGAAGCCTCTGGAGG + Intergenic
1139022069 16:62762075-62762097 ACAGAAAGTCAAGCTTCTGATGG - Intergenic
1140665251 16:77221657-77221679 AGGGAAAGGAATGCCCGTGAAGG - Intergenic
1140834673 16:78782124-78782146 GGGGAAATTAAAGCCAGTGAAGG - Intronic
1141292224 16:82729278-82729300 AGAGATAGTAATTCCTCTGATGG - Intronic
1142548017 17:719028-719050 AAGGAATGGGAAGCCTCTGACGG + Intronic
1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG + Intronic
1143736871 17:8917026-8917048 AGGGAGAGTCAAGCCTCGGAAGG - Intronic
1144490169 17:15701681-15701703 TGGAAAAGGAAAGCCTATGAAGG + Intronic
1144910795 17:18680276-18680298 TGGAAAAGGAAAGCCTATGAAGG - Intronic
1146395055 17:32458250-32458272 AGGCAATGGAAAGCCACTGAAGG - Intronic
1148323444 17:46770765-46770787 AGGGAAAGGAGAGACTCTCAAGG + Intronic
1149775341 17:59352810-59352832 AGGGAAAGTTCAGCCTCTAGAGG - Intronic
1150032786 17:61757410-61757432 AGTGAAAGTAAGACCTCTGTTGG + Intronic
1151002705 17:70397129-70397151 AGATAAAGTGAAGTCTCTGAGGG + Intergenic
1151979569 17:77500415-77500437 AAGGAAAGTGAAGCATCTCAAGG - Exonic
1151980804 17:77507329-77507351 AGGAAATGTAAGTCCTCTGAAGG + Intergenic
1157147844 18:45183614-45183636 AAGGAAAGAAAAGGCTCAGATGG - Intergenic
1157227236 18:45877872-45877894 AGGGAAAAAAAAGACTCAGAAGG + Intronic
1157454520 18:47813975-47813997 AGGGAAAGAAAAGTCTGTGGTGG + Exonic
1163127430 19:15251809-15251831 AGGCAAAGGAAAGCCCCTGCTGG + Intronic
1164511001 19:28897185-28897207 AGACAAAGTGAAGCTTCTGAAGG - Intergenic
1165849068 19:38838665-38838687 AGGGCAAGCTAAGCCTCTGGAGG - Intronic
926057642 2:9784387-9784409 ATAGATAGTAAATCCTCTGATGG + Intergenic
927192407 2:20525620-20525642 AGGGACAGGAAAGCCTCTGCAGG + Intergenic
929302750 2:40324854-40324876 AGGAAAAGAACATCCTCTGATGG + Intronic
929366284 2:41160307-41160329 AGGGAAGGTAAAGTCACAGATGG - Intergenic
931021342 2:58047416-58047438 AGGGAAACGACAGCCTCTCAGGG - Intronic
931250255 2:60524372-60524394 GGGGAAAGTAGAGCCTCTGGGGG + Intronic
933414297 2:81966390-81966412 AGGAAAAGTGATTCCTCTGATGG + Intergenic
938998510 2:136706482-136706504 AGGAAAAGTAGAGCAACTGAAGG - Intergenic
939064240 2:137463523-137463545 AGAGAAAGAAAAGCCACAGAAGG - Intronic
939378390 2:141400626-141400648 AGAGAAAGTGAAGTGTCTGAAGG - Intronic
939476490 2:142694195-142694217 AAGGAAAGATAAGCCTCAGATGG + Intergenic
939779387 2:146426449-146426471 AAGGAAAGTAAAGGCCCTAAAGG + Intergenic
940565291 2:155352469-155352491 ATGGAAAGTAAAACCACAGATGG - Intergenic
940710386 2:157155565-157155587 AAGGGAAGAAAAGCCTCAGATGG + Intergenic
941230358 2:162904272-162904294 AGGAAAACTACAGCTTCTGAAGG + Intergenic
941366301 2:164615725-164615747 AGTAAGAATAAAGCCTCTGAAGG - Intronic
941517525 2:166497842-166497864 AAGGAAAGTAAAGTCTCCCAGGG - Intergenic
942956194 2:181776334-181776356 ATATAAATTAAAGCCTCTGAAGG - Intergenic
944322273 2:198361022-198361044 AGGGAATGTAAAAACTTTGAAGG - Intronic
944465054 2:199992622-199992644 ATGGCCAGTAAAGGCTCTGAAGG + Intronic
944923982 2:204444131-204444153 ATGGAAAGCACAGCCTCTCAGGG - Intergenic
945748109 2:213744074-213744096 AGCAAAAGTAAATCCTCTGAAGG - Intronic
949000078 2:241608133-241608155 AAGGAAAGCAAAGGCTCTGGGGG + Intronic
1169759166 20:9072822-9072844 AGGGAAAATAAACACTCTGCTGG - Intronic
1169839485 20:9919326-9919348 AATGAAAGTAAAGTCTCTGGAGG - Intergenic
1170804385 20:19617021-19617043 AGGGAATGTAAAGCTCATGAGGG - Intronic
1171037187 20:21724523-21724545 AGGGAGAGAAGAGCCACTGAAGG - Intergenic
1174349774 20:49958608-49958630 AGGGTAACTGAAGCCACTGAAGG - Intergenic
1175133873 20:56808670-56808692 AGGGGCAGAGAAGCCTCTGAAGG - Intergenic
1177567414 21:22843359-22843381 GGAGAAAGTTAGGCCTCTGAGGG - Intergenic
1179011137 21:37557227-37557249 AGGAAAAGTAAAGCAGGTGAGGG - Intergenic
1179890650 21:44333577-44333599 AGGAAAATTAAGGCCTCTCAGGG + Intronic
1179982698 21:44904935-44904957 AGGCCAAGTGAAGCCTCTGAGGG - Intronic
1180390254 22:12224345-12224367 GGGGAAGGGAAAGCCTCTAAGGG - Intergenic
1180415681 22:12710122-12710144 GGGGAAGGGAAAGCCTCTAAGGG + Intergenic
1182317007 22:29454366-29454388 AGGGTCAGGGAAGCCTCTGAGGG - Intergenic
1182795709 22:32990180-32990202 AGGGAAAGTGGAGCCTGTCAAGG + Intronic
1183503351 22:38194472-38194494 AGACAAAGGACAGCCTCTGAAGG + Intronic
1185113629 22:48918845-48918867 AGGAAAAGAAGAGGCTCTGAGGG + Intergenic
950464366 3:13144577-13144599 AGGGGGAGTAAAGTCTCTTAAGG - Intergenic
950993293 3:17464963-17464985 AGATAAAGAAAAGCCTCTGGTGG + Intronic
951230942 3:20179122-20179144 AGGGAGAGGAAAGCCTCTTGTGG + Intronic
951455351 3:22886101-22886123 AGGAAAAGTGACGCCTCTGAGGG - Intergenic
953989235 3:47471207-47471229 AGGGAAAGGCAAGGCTCAGAGGG + Intronic
955844639 3:63149238-63149260 AGTGCAAGGAAAGCCACTGAAGG + Intergenic
957101940 3:75838620-75838642 GGGGAAGGGAAAGCCTCTAAGGG - Intergenic
957408272 3:79800730-79800752 AGGGTAAGGAAGGCTTCTGAAGG - Intergenic
962414490 3:135169624-135169646 GGGGAAACTGAAGGCTCTGATGG + Intronic
962909849 3:139837964-139837986 GGCAAAAGTGAAGCCTCTGATGG - Intergenic
963293095 3:143513631-143513653 ATGGAAAGTGATTCCTCTGATGG - Intronic
963996310 3:151713432-151713454 AGTGAAGGTAATGTCTCTGATGG - Intergenic
967920305 3:194609409-194609431 GGGGAAAGAAGAGCCTGTGAGGG + Intronic
968772184 4:2514499-2514521 AGGCAACATTAAGCCTCTGAGGG - Exonic
969701066 4:8768096-8768118 TGGGAAAGTAAAGCCAAGGACGG - Intergenic
970307320 4:14747201-14747223 AGGGAAAGGAGAGCCTGTGTTGG - Intergenic
970861121 4:20703694-20703716 AGGGAAATAAAAGCCTGTCAAGG - Intronic
971557166 4:28027656-28027678 AGCGTAAGTGAAGCATCTGAGGG + Intergenic
971992451 4:33916723-33916745 AGAGAAAGTAATGCCTTAGAAGG - Intergenic
972382070 4:38528588-38528610 AAGGAAATTAAAGCTTCTGAAGG - Intergenic
974326465 4:60420702-60420724 AGGGAAAGTAAATAATCTCATGG - Intergenic
976557816 4:86469008-86469030 TGGGAAAGCAAAGACTCAGAGGG + Intronic
981686202 4:147457651-147457673 AGGGTAGGTAAAGATTCTGATGG - Intergenic
984994990 4:185421836-185421858 AGAGAATGTAATGTCTCTGAAGG - Intronic
987137279 5:14912078-14912100 AGGGAAACTGGAGCCCCTGAGGG - Intergenic
987336750 5:16904072-16904094 AGGGAAAGGAAAGGGGCTGAAGG + Intronic
987853437 5:23387145-23387167 ATAGATGGTAAAGCCTCTGAGGG - Intergenic
990867012 5:60390815-60390837 AGGAAATGCAAAGGCTCTGAGGG - Intronic
990908600 5:60830581-60830603 AAGAAAAAAAAAGCCTCTGATGG - Intronic
991019674 5:61967080-61967102 TGGGAAGGAAAAGCCACTGAAGG + Intergenic
991194951 5:63921712-63921734 AGGCAATGTAAAACCTCTGAGGG + Intergenic
991469469 5:66952723-66952745 AGCGATTGTAAAGTCTCTGACGG - Intronic
992743858 5:79799930-79799952 TGGTAAAGGAAATCCTCTGATGG + Exonic
995727912 5:115202145-115202167 AGGTAAATGAATGCCTCTGATGG - Intergenic
996433991 5:123414159-123414181 AGAGAAGGTAAATCCTCTTAGGG - Intronic
998148553 5:139744373-139744395 AGGGAAAGTAAAGTCAGAGAGGG - Intergenic
998321928 5:141240869-141240891 GTGGATATTAAAGCCTCTGATGG + Intergenic
1000502918 5:162075101-162075123 AAGGAAAGAAAAGGCACTGAGGG + Intronic
1000704895 5:164498666-164498688 AGGCAAAGAAAAGCCTATGAAGG - Intergenic
1001355256 5:171015913-171015935 AGGGAAAGAAAACCATCAGAAGG - Intronic
1001365785 5:171138431-171138453 AGAGAAAGTGAAGCCCCAGATGG + Intronic
1002690893 5:181049876-181049898 GGGGACAGTAATGCCCCTGAGGG - Intronic
1003331029 6:5128925-5128947 AGGCAAAGTCAAGCCTTTGAAGG - Intronic
1004550419 6:16641764-16641786 ACAGAAAGTAATTCCTCTGATGG + Intronic
1005134473 6:22551973-22551995 AGGGTAACTAAATCCTCTCAAGG + Intergenic
1007255500 6:40525303-40525325 AGGCAAATTACAGCCTCTCAAGG + Intronic
1007731642 6:43951162-43951184 AGGGCAAGTAAAGCCTGGAATGG + Intergenic
1008478380 6:51958244-51958266 AGGGAGAGTAAGTCATCTGAAGG - Intronic
1008595274 6:53035766-53035788 AGGGAAAGGAAGGTCACTGAAGG - Intronic
1008957413 6:57230902-57230924 AGATACAGTACAGCCTCTGAAGG - Intergenic
1009697604 6:67128921-67128943 AGGAAAAGTAAAAGCTCTGTTGG - Intergenic
1010850708 6:80773009-80773031 GGGCAGATTAAAGCCTCTGATGG - Intergenic
1011196966 6:84791380-84791402 TGGGAAACTAAAGCCTCTTGTGG + Intergenic
1011333510 6:86235550-86235572 AAGGAAAATAAAACCTCAGAAGG + Intergenic
1011891401 6:92165299-92165321 AGGTAATGTAATGCCTCTGGTGG + Intergenic
1012692852 6:102336576-102336598 AGGGAAATTAAAGTCACAGATGG - Intergenic
1012961521 6:105627299-105627321 ATGGAAATTAAAGTGTCTGATGG - Intergenic
1014629603 6:123772599-123772621 AGTGATGGAAAAGCCTCTGACGG - Intergenic
1014923901 6:127247773-127247795 AAGGAGAGAAAAGCATCTGATGG + Intergenic
1017221099 6:151967034-151967056 ATGGAAAATAAAGGCTATGAAGG + Intronic
1018184224 6:161251886-161251908 AGGGAATGGAAGGCCTATGATGG + Intronic
1018369814 6:163157293-163157315 AGGGAAGGTAAGGCCACTCAAGG - Intronic
1019937522 7:4266098-4266120 AGGGAGAGGGAAGCCTCTTAGGG + Exonic
1020182755 7:5934891-5934913 CTGGAAAGTAAAGCCCATGAGGG + Intronic
1020300157 7:6789866-6789888 CTGGAAAGTAAAGCCCATGAGGG - Intronic
1022743332 7:33144191-33144213 TGGGAAAGTATAGCCTCTAGAGG - Intronic
1023293404 7:38690371-38690393 AGGGCAAGGAAGGACTCTGAGGG + Intergenic
1023564010 7:41505606-41505628 AAGGAAAGAAAAGCCTATGCAGG - Intergenic
1023626992 7:42125532-42125554 AGGCAACGCTAAGCCTCTGATGG + Intronic
1025849596 7:65235278-65235300 AGAGAAAAGAAAGCCTCAGATGG + Intergenic
1026140737 7:67704194-67704216 AGGGACAGTAAATACTTTGAAGG - Intergenic
1026388041 7:69871300-69871322 AGGGAAAGTATAGGCTCCCAAGG + Intronic
1027426546 7:78067073-78067095 ATGGAAAGTAGAACCTCTGGAGG + Intronic
1028036031 7:85983536-85983558 AGCAAAAGTAAAGCCTGGGATGG - Intergenic
1028281204 7:88930730-88930752 AGGGAAAGGAAAACTTTTGATGG + Intronic
1028343090 7:89746572-89746594 AAGGAAAAAAAAGCCTCAGATGG + Intergenic
1028545939 7:91999804-91999826 AGAAAAAGAAAAGCCTCAGAGGG - Intronic
1029538038 7:101167184-101167206 TGGGAAAGTCGAGCCACTGATGG - Intergenic
1030828213 7:114187463-114187485 ACGGACAGTAAAGACTCAGATGG - Intronic
1032819924 7:135514633-135514655 AGGAAAAGGAAAGCCTATGGAGG + Intergenic
1033258294 7:139820622-139820644 AAGGAAAGGAAAGCCATTGAAGG - Intronic
1033956878 7:146860380-146860402 AGTGAATGCAAAGTCTCTGAGGG + Intronic
1034094028 7:148389835-148389857 AGGGAAAGGAAGCCATCTGAAGG + Intronic
1034596283 7:152196613-152196635 TGAGAAAGTAAGCCCTCTGAGGG - Intronic
1036513845 8:9425167-9425189 GGGGAAAATAAAGCTTCTCAGGG - Intergenic
1037903989 8:22704688-22704710 AGGGAAAGTCTGGTCTCTGAAGG + Intergenic
1041783179 8:61601141-61601163 AGGGCTACCAAAGCCTCTGATGG - Intronic
1041971117 8:63743600-63743622 AGAGAAAGAGAAGCCACTGAGGG + Intergenic
1042111639 8:65387498-65387520 AGGGCAAGGACAGCCTCTGGGGG - Intergenic
1043514179 8:80981065-80981087 AGGGAAAGTCAAGGAACTGAAGG - Intronic
1043887048 8:85612853-85612875 AGGAAAAGGAAATCCTCTCAGGG + Intergenic
1044234054 8:89809730-89809752 AGAAAAAGTTAAGACTCTGAGGG + Intergenic
1045388719 8:101694261-101694283 AGAGAAAGGAAAGCAGCTGAGGG + Intronic
1046389922 8:113557235-113557257 AGAGAAATTGAAGCCTTTGATGG + Intergenic
1047436404 8:124838886-124838908 ATGGGAGGCAAAGCCTCTGAGGG + Intergenic
1048208221 8:132432547-132432569 ATGGAAAGGCAAGCCTCTTAAGG - Intronic
1049148330 8:141018352-141018374 AGGCAAAGAAAAGCCTGCGATGG - Intergenic
1050073155 9:1837670-1837692 AGGGAAAGTGAAGCCCATGTGGG - Intergenic
1050496138 9:6244608-6244630 ATGGAAAGTAAACCCACAGATGG + Intronic
1051191998 9:14523037-14523059 AGGGAAAGAAAAGTTTCTGCTGG + Intergenic
1051744674 9:20284041-20284063 ACGGAGAGTCAAGCCACTGATGG - Intergenic
1051809557 9:21033376-21033398 AGAGAAAGTAAAGTCCCAGATGG + Intergenic
1053593957 9:39541198-39541220 AGGGAAATAAAAGACTCAGAAGG + Intergenic
1053851741 9:42296253-42296275 AGGGAAATAAAAGACTCAGAAGG + Intergenic
1054572293 9:66823755-66823777 AGGGAAATAAAAGACTCAGAAGG - Intergenic
1055377546 9:75666195-75666217 AGGGAACCTAAAGACTCTGTCGG - Intergenic
1056912383 9:90714104-90714126 AGTGAATGCAAACCCTCTGAAGG + Intergenic
1057971405 9:99561725-99561747 AGGGAAAGTACAATTTCTGAGGG - Intergenic
1058228871 9:102400795-102400817 AAGGAAAGTAAAGGATCTAAAGG - Intergenic
1060136251 9:121157878-121157900 AGAGTAAGTAAGGCCTCTGTAGG + Exonic
1060298540 9:122360076-122360098 AGGGAAAGTGAAGATTCTGCGGG - Intergenic
1060525911 9:124321307-124321329 AGGGAAAGAAAGGCCTGTGCTGG - Intronic
1186656717 X:11619931-11619953 AGGGACAGTGAAGACTGTGAGGG - Intronic
1186853000 X:13598674-13598696 AGGAAAAGAAAAGCCTAGGAGGG - Intronic
1187726848 X:22212209-22212231 ATGGAAAGTATGGCCTCTTAGGG + Intronic
1188031164 X:25265880-25265902 GGGGAAAGGATAGCCACTGATGG + Intergenic
1189933873 X:46044044-46044066 AGTGATAGTAAATCATCTGATGG - Intergenic
1190311780 X:49122148-49122170 AGGAAATGTAAAGGCCCTGAAGG - Intronic
1193058447 X:77179429-77179451 AAGGAAAGTATAGCCTCTTAAGG + Intergenic
1193251969 X:79301680-79301702 AAGCAAAGAAAAGCCTCAGATGG - Intergenic
1194253410 X:91605432-91605454 AGGCAAACAAAAGCTTCTGAGGG + Intergenic
1194773288 X:97931047-97931069 TGAGAAAGTAAAGCTTCTGAGGG - Intergenic
1194797030 X:98224672-98224694 TGGAAAAGTAAAGCCTTTTATGG - Intergenic
1195825669 X:108997862-108997884 AGGCAAAAGAAAGCCACTGAAGG - Intergenic
1196335946 X:114534563-114534585 GGGAAAAGTAAAGCCTGGGAAGG - Intergenic
1197956538 X:131955421-131955443 AGGAAAAGAAAAGACTCTTAAGG - Intergenic
1199435213 X:147805219-147805241 TGGGAAAGCAAAGTTTCTGAAGG + Intergenic
1200334138 X:155330792-155330814 AGGGAAAGTCAGGGATCTGAGGG + Intronic
1200572189 Y:4845023-4845045 AGGCAAACAAAAGCTTCTGAGGG + Intergenic