ID: 1128562212

View in Genome Browser
Species Human (GRCh38)
Location 15:68676393-68676415
Sequence CCGGGGGCCAATCTAGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 38}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128562202_1128562212 2 Left 1128562202 15:68676368-68676390 CCTGGCCCACCTTAGCCTTTAAT 0: 1
1: 2
2: 2
3: 28
4: 255
Right 1128562212 15:68676393-68676415 CCGGGGGCCAATCTAGCTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 38
1128562203_1128562212 -3 Left 1128562203 15:68676373-68676395 CCCACCTTAGCCTTTAATTTCCG 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1128562212 15:68676393-68676415 CCGGGGGCCAATCTAGCTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 38
1128562201_1128562212 5 Left 1128562201 15:68676365-68676387 CCTCCTGGCCCACCTTAGCCTTT 0: 1
1: 0
2: 2
3: 28
4: 280
Right 1128562212 15:68676393-68676415 CCGGGGGCCAATCTAGCTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 38
1128562208_1128562212 -7 Left 1128562208 15:68676377-68676399 CCTTAGCCTTTAATTTCCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1128562212 15:68676393-68676415 CCGGGGGCCAATCTAGCTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 38
1128562204_1128562212 -4 Left 1128562204 15:68676374-68676396 CCACCTTAGCCTTTAATTTCCGG 0: 1
1: 0
2: 0
3: 2
4: 76
Right 1128562212 15:68676393-68676415 CCGGGGGCCAATCTAGCTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128562212 Original CRISPR CCGGGGGCCAATCTAGCTTC AGG Intronic
900934424 1:5756196-5756218 CCGGGGCCCATTCCAGCTTCTGG + Intergenic
901792546 1:11661925-11661947 CCTGGTACCCATCTAGCTTCTGG - Exonic
902159355 1:14517410-14517432 CCAGGGGCAGATTTAGCTTCGGG - Intergenic
902593365 1:17490915-17490937 CCGTGGGCCAAGCTAACTTTGGG + Intergenic
1062939173 10:1409122-1409144 CCGTGGGCCAAGCGTGCTTCAGG - Intronic
1067150613 10:43729598-43729620 CCAGGGGACAATGGAGCTTCAGG + Intergenic
1080645387 11:34184330-34184352 CCCGGGGCCAAGGTGGCTTCTGG + Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1092478738 12:8841098-8841120 CCGGTGGCTAATGAAGCTTCAGG - Intronic
1102412557 12:112732680-112732702 TCGAGGGCCATTCTAGCTCCAGG - Intronic
1102694369 12:114786705-114786727 CCAGGGGCCATTCTAGGTGCTGG + Intergenic
1103919829 12:124393506-124393528 CCGGTGGCCCCTCTACCTTCTGG + Intronic
1126193384 15:45902908-45902930 ACGGGGGCCAATCTAACCACTGG + Intergenic
1128562212 15:68676393-68676415 CCGGGGGCCAATCTAGCTTCAGG + Intronic
1129964545 15:79722300-79722322 CCAGGGGAGAATCCAGCTTCAGG - Intergenic
1133479398 16:6155453-6155475 CGGGGGGAAAATCTACCTTCCGG - Intronic
1135548607 16:23381537-23381559 CTGGGGGCCAAACTGGCTTCAGG - Intergenic
1143047125 17:4090602-4090624 CCAGAGGCGAATCTACCTTCAGG - Intronic
1143875592 17:9988321-9988343 CCTGGGGGCAAGCCAGCTTCTGG - Intronic
1154205851 18:12336060-12336082 GTGTGGGCCAAGCTAGCTTCGGG + Intronic
1161384343 19:3983052-3983074 CCGGGGGCCATCCTTGCTTGAGG - Intronic
1161492452 19:4569687-4569709 CCAGGGACCAAGCCAGCTTCTGG - Intergenic
1164643246 19:29841642-29841664 CCAGGGGCCTATCTAGCCTCAGG + Intergenic
926273846 2:11388655-11388677 GTGAGGGCCATTCTAGCTTCTGG + Intergenic
938146110 2:128836006-128836028 ACGGGGGCCACTTTAGGTTCAGG - Intergenic
943299202 2:186176227-186176249 GCTGGGGCCAATCTAACTGCAGG + Intergenic
1179293832 21:40043153-40043175 TCGGGGGCCATTCTGGCTTGTGG - Intronic
1182533234 22:30978780-30978802 CCAGGGGATATTCTAGCTTCAGG - Intergenic
1183925818 22:41205244-41205266 CCGCGGGCCAATCACGCTGCAGG - Exonic
1184671050 22:46012521-46012543 CCGGGGGCCCATGTGGCTGCCGG - Intergenic
1184831790 22:46993607-46993629 CCGAGGGCAAATCTGGTTTCTGG + Intronic
965537710 3:169841200-169841222 CAGGGCCCCAATCTATCTTCTGG + Intronic
975311698 4:72910950-72910972 CCAGGGGCTATTCTAGCTGCAGG - Intergenic
980244682 4:130223973-130223995 TAGGGGGCTAGTCTAGCTTCAGG + Intergenic
1000258390 5:159562345-159562367 CCAGGGGCAAATCTAACTTCAGG - Intergenic
1000433518 5:161179980-161180002 CCCAGGGCCATCCTAGCTTCAGG + Intergenic
1021598037 7:22337603-22337625 CCGTGGGCCAAGCTAACTTTGGG - Intronic
1030150793 7:106403051-106403073 CCAGGGGCCCACTTAGCTTCAGG + Intergenic
1044878799 8:96700850-96700872 CCTGGGGCCAGCCAAGCTTCAGG - Intronic
1045106162 8:98894863-98894885 CCTGGTGCCATTCTAGATTCTGG - Intronic
1061503669 9:131018500-131018522 CCAGGGGCCAATGAGGCTTCTGG + Intronic
1062727472 9:138083726-138083748 CAGGGGGCAAGTCTAGCTCCAGG - Intronic
1196184467 X:112731195-112731217 CCTTGGGCCAAGCTAACTTCGGG + Intergenic