ID: 1128564550

View in Genome Browser
Species Human (GRCh38)
Location 15:68692008-68692030
Sequence CTGTGGAAGCAGATGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 293}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128564550 Original CRISPR CTGTGGAAGCAGATGATGCA GGG Intronic
901025289 1:6275922-6275944 CTGTGCAACCACATTATGCAGGG - Intronic
901447621 1:9317969-9317991 CTGTGGAACCAGAGGAAGCTGGG + Intronic
902099560 1:13974701-13974723 CTGAGGAAGCAAAGGAAGCAAGG + Intergenic
902554715 1:17240152-17240174 CTGTGGGAACAGGTGAAGCAAGG + Intronic
902601100 1:17540444-17540466 CTGTGGGAGGAGAGGATGCCGGG + Intronic
903618735 1:24682188-24682210 CTCCGGAAGCAGAGGTTGCAGGG - Intergenic
904046067 1:27609229-27609251 CTGAGGGTGCAGATGAGGCATGG - Intergenic
904544137 1:31255164-31255186 CTGTGGAACCAAATGATGCCAGG - Intergenic
904779622 1:32935820-32935842 CTGGGGAGGCAGAGGTTGCAGGG - Intergenic
908466711 1:64403099-64403121 CTGCGGAGGCAGAAGATGGAGGG + Intergenic
908654334 1:66371986-66372008 CTTTGGAATCAGATGAAGCTGGG + Intronic
908685690 1:66716858-66716880 ATGTGGAAGCAAATGAGGCTTGG - Intronic
910189002 1:84575500-84575522 TGGAGGAAGCAGATGCTGCAGGG + Intergenic
910283100 1:85523225-85523247 AAGTGGAAGTAGATGAGGCAAGG + Intronic
912837645 1:113010469-113010491 CTCTGGAAGCGGAGGTTGCAAGG - Intergenic
915718864 1:157968906-157968928 CTGTGCAAGCTGATGAAGGAGGG - Intergenic
916087730 1:161283058-161283080 GGGTGGAAGCAGATTATGTAGGG - Intronic
916190286 1:162171461-162171483 AAGTGGAAGCAGTTGAGGCAGGG - Intronic
917539561 1:175899671-175899693 CTATGGAGGAAGATGAAGCAAGG + Intergenic
919469169 1:197957586-197957608 CAGGGGAAGCTGATGATGCAGGG + Intergenic
920447610 1:206030993-206031015 CTTTGGAAGCAGACAAAGCAAGG + Intergenic
920713221 1:208315399-208315421 CTGTAGAAGCAGATGGGGAAAGG + Intergenic
921187361 1:212682181-212682203 CTGTGAAAGCTGAGGATGCTTGG + Intergenic
921429741 1:215051666-215051688 CTTGGGAAGCAGCAGATGCAAGG + Intronic
922228009 1:223662371-223662393 CTGGGGAGGCAGAGGTTGCAGGG + Intronic
922468343 1:225860205-225860227 CTGTGCAAGGAGCTGAGGCAGGG + Intronic
923218601 1:231873040-231873062 CTGTGGAAGAAGATGGTGGGAGG + Intronic
1063590336 10:7389143-7389165 CTGTGGAAACAGATAATTCTTGG + Intronic
1064160560 10:12941927-12941949 CTTTTGAAGTAGATGATTCAAGG - Intronic
1064628216 10:17282983-17283005 CTGTGGAAGCAGCTGAGGTGGGG + Intergenic
1067352505 10:45488967-45488989 GTCTGGAAGCAGGTGATCCAGGG - Intronic
1067830004 10:49606164-49606186 CTCTGGAACCAGATGTTTCAGGG + Intergenic
1069547800 10:69341235-69341257 CTGGGGAAGCAGAGGTTGCAGGG - Intronic
1069625425 10:69864975-69864997 CTGAGGAAGCAGCAGGTGCATGG + Intronic
1071494224 10:86156707-86156729 ATGTGGCAGCAGATGAGGAAGGG + Intronic
1074916355 10:117959806-117959828 CTATGGAAGCCTCTGATGCAGGG + Intergenic
1075611763 10:123860213-123860235 CAGAGGAAGGAGATGATCCAGGG + Intronic
1075917306 10:126179789-126179811 CTGGGGTAGCAGTTCATGCATGG + Intronic
1077278248 11:1728069-1728091 CTGGGGAAGCAGCTGATTCCAGG - Intergenic
1078088146 11:8247040-8247062 TTGTGGAAGCAGATGGGCCAAGG - Intronic
1078273529 11:9820284-9820306 CTTTGGAAGCAGAAAATGAAGGG + Intronic
1079291495 11:19192120-19192142 CTGGGCAAGCAGTTGAAGCAAGG + Intronic
1079304131 11:19307681-19307703 TTGTGGATGAAGATGAAGCATGG - Intergenic
1079385807 11:19978337-19978359 CTGTGAAAGCATATGATGTTTGG + Intronic
1080793253 11:35539840-35539862 CTGTGGGAGGGGATCATGCAAGG - Intergenic
1081906263 11:46672392-46672414 GGGTGGGAGCAGCTGATGCATGG - Exonic
1083133183 11:60646544-60646566 CTTTGAAAGAAGATGAGGCAGGG - Intergenic
1083696383 11:64445583-64445605 CTATGGAAGCAGAAGACGCCAGG + Intergenic
1084570892 11:69959306-69959328 CTGTGGAATAAGGTGATGCTCGG - Intergenic
1087268500 11:96086818-96086840 CTGTGGATTCAGATAAGGCAAGG + Intronic
1089065619 11:115659811-115659833 CTGCGGAAGCAGAGGCTGCGGGG + Intergenic
1090850059 11:130564148-130564170 CTTTGGTAGCAGGTGAGGCAAGG + Intergenic
1091503726 12:1044682-1044704 CTCTGGTAGCAGATCATGAAAGG - Intronic
1092913334 12:13167393-13167415 CTGTGGAAGGAAATGATGTCTGG + Intergenic
1093053455 12:14531704-14531726 CCCTGGAAGCAGAGGTTGCAGGG - Intronic
1094646418 12:32328870-32328892 CTGTGGAAACAGGAGATGGAGGG + Intronic
1095294623 12:40514061-40514083 CTGTGGAAAGAAATGTTGCATGG + Intronic
1096741820 12:53699067-53699089 CTGTGGATGCAGCTGCTCCAGGG - Intergenic
1096748669 12:53744991-53745013 CAGTGGCAGCAAATGAGGCAGGG - Intergenic
1097309737 12:58105479-58105501 CTGTGTAGACAGATGATGCTGGG + Intergenic
1098328364 12:69326024-69326046 CTGGGGAGGCAGAGGTTGCAGGG + Intergenic
1100359252 12:93861152-93861174 CTGAGGGAGCAGAGGCTGCAGGG + Intronic
1101456077 12:104832108-104832130 CTTCAGAAGCAGATGATCCATGG + Intronic
1101652938 12:106694270-106694292 CTGTGGAAGTACAGGATGGAAGG - Intronic
1101922981 12:108947884-108947906 CTGTGAAGGCAGATGGTGCTGGG + Intronic
1102034281 12:109761954-109761976 CTGGGGAAGCAGTTGGTGCAGGG - Intronic
1102697715 12:114813250-114813272 CTGAGGAAGCAGAGGAAGTAGGG - Intergenic
1104267066 12:127243747-127243769 CTAAAGAAGCAGGTGATGCATGG + Intergenic
1104379102 12:128291481-128291503 CTGCGGGAGGAGATGATGCTGGG + Intronic
1107322647 13:39205820-39205842 ATGGGGAAGGAGAGGATGCAGGG - Intergenic
1107502731 13:40997204-40997226 CTGTGAAAACAGATCATTCAGGG - Intronic
1108418142 13:50221712-50221734 GTGTGGAGGCAGGTGCTGCATGG + Intronic
1113801201 13:113087250-113087272 CTGGGCAAGCTGCTGATGCAGGG + Exonic
1114435289 14:22701489-22701511 TTGTGGAAGGAGATAATGAAAGG + Intergenic
1115945438 14:38654501-38654523 CTGTGGAGGAAAATGAAGCAGGG - Intergenic
1115992393 14:39163535-39163557 CTGTGGAGACAGATTAAGCAAGG - Intronic
1117956290 14:61125995-61126017 CTGGGGAAGCAGATGTCCCAAGG - Intergenic
1118516334 14:66532407-66532429 CAGAGGAAGCAGAAGATGCCAGG + Intronic
1118591516 14:67405559-67405581 ATGTGGAAGGAGACTATGCAAGG - Intronic
1118672370 14:68143334-68143356 GTGTGGAAGGAAATGATACATGG + Intronic
1119180873 14:72604629-72604651 CTGTGGACACAGATGACCCAGGG + Intergenic
1120932406 14:89862013-89862035 CTGTGGAAGGAGATTAGGTAAGG - Intronic
1121088921 14:91167902-91167924 CTGGGAAAGCAGATGATGACAGG - Intronic
1127104218 15:55595957-55595979 TTGTGGAATCTGATGATGGATGG - Intergenic
1128352630 15:66901240-66901262 CTGGGGAACCAGAAGAGGCAGGG + Intergenic
1128564550 15:68692008-68692030 CTGTGGAAGCAGATGATGCAGGG + Intronic
1128783921 15:70380763-70380785 CTCTGGATGCAGATGAAGCTGGG - Intergenic
1128940852 15:71786673-71786695 CTGTAGAAGAAGATGAGGAAAGG + Intergenic
1129029337 15:72607297-72607319 TTAGGGTAGCAGATGATGCAGGG - Intergenic
1130144534 15:81263814-81263836 CTGTGGATGGAGAGAATGCAGGG + Intronic
1130484380 15:84390496-84390518 CCAGGGTAGCAGATGATGCACGG - Intergenic
1130510937 15:84588596-84588618 ATGCGGAAGCCGATGTTGCATGG - Intergenic
1130555659 15:84920824-84920846 GTGTGGAAGAAGAAGATGAATGG + Intronic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1131683406 15:94747380-94747402 TTGGGGAAGCAGATGTTGAACGG - Intergenic
1133288345 16:4701786-4701808 CTATGGAAACAGCTGCTGCACGG + Intronic
1135416874 16:22275128-22275150 CTGGGGAAGCACATCATGCATGG + Intronic
1135434933 16:22420526-22420548 CTGTGGATGCAGGAGATGGACGG - Intronic
1135971515 16:27075289-27075311 CTGTGGAAGCAGAAACTGCAAGG - Intergenic
1137540067 16:49355975-49355997 CAGTGGAGGCAGATGACACATGG + Intergenic
1138461078 16:57148128-57148150 CTGAGGAAGGAGCTGACGCAGGG - Exonic
1141150311 16:81560070-81560092 CTGGGGAGGCAGAGGTTGCAGGG + Intronic
1142044116 16:87914302-87914324 CTGTGGATGCAGGAGATGGACGG - Intronic
1142724893 17:1805734-1805756 CTCAGGAAGCAGAGGTTGCAGGG + Intronic
1144343056 17:14326393-14326415 CTGTGGAAGCAAGGGATGGAGGG + Intronic
1148376229 17:47149001-47149023 CTCGGGAAGCAGAGGTTGCAGGG + Intronic
1148758170 17:49985505-49985527 CTGTGGAGGCAGAGCCTGCATGG - Intergenic
1149096328 17:52845272-52845294 CTGTGTAACCAGATGATCCTGGG + Intergenic
1151199235 17:72455646-72455668 CTTGGGAGGCAGATGCTGCAAGG - Intergenic
1151670264 17:75568400-75568422 CTGTGGAATCAGAAGCTCCAGGG - Intronic
1151821052 17:76497157-76497179 CTGTGCCAGCAGGTGGTGCAGGG - Intronic
1152612530 17:81322792-81322814 CGGTGGCAGCAGCTGGTGCAGGG - Intronic
1152702520 17:81826063-81826085 CACTGGAGGCAGAGGATGCATGG - Exonic
1155107782 18:22684709-22684731 CCGTGGAGGCAGAGGTTGCAGGG + Intergenic
1155500134 18:26479517-26479539 CCGTGGAAGCAGAGCAGGCAAGG + Intronic
1155683748 18:28521197-28521219 CTGGGGCAGTAGATGATGCTGGG + Intergenic
1157111507 18:44824819-44824841 CTAGGGAAGCAGATGAAGAAAGG + Intronic
1157328346 18:46685427-46685449 CTGTGACAGCAGGTGACGCAGGG + Intronic
1158803801 18:60945593-60945615 CTGTGGTTGCAGATGAAACATGG + Intergenic
1159128719 18:64255575-64255597 CTTTGGAATCAGATGCTCCAAGG - Intergenic
1159706991 18:71702855-71702877 CTGGGGAAGCAGAAGACACATGG + Intergenic
1159859066 18:73625671-73625693 CTGGGATAGCAGATGATGCTTGG - Intergenic
1159977340 18:74730149-74730171 CTGTGGAAGGAAATTGTGCATGG + Intronic
1160111653 18:76037781-76037803 CTATGGGAACAGATAATGCAGGG - Intergenic
1160778637 19:868113-868135 CTCTGGATGCAGATGGTCCAGGG + Exonic
1160839837 19:1141288-1141310 CTCGGGAAGCAGAGGTTGCAGGG - Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162349133 19:10138246-10138268 CTAGGGAAGCAGATGATGCAGGG + Intronic
1162666984 19:12221910-12221932 CTGTGGAAGGAAATCATGGATGG - Intergenic
1162801496 19:13113232-13113254 CTGGGGAAGCGGAGGTTGCAGGG - Intronic
1163233061 19:16016704-16016726 CTGGGGATGCAGATGGGGCAGGG - Intergenic
1164470216 19:28523630-28523652 CTGTGCAAACAGTTGATGTATGG + Intergenic
1167069291 19:47210699-47210721 CGGCGGGAGCAGGTGATGCAGGG - Intergenic
1167874631 19:52401480-52401502 CTGGGGAAGCAGATCAGGCAGGG - Intronic
925615506 2:5741074-5741096 CTGCGGAAGCAGAGGATGGAAGG - Intergenic
925842985 2:8009660-8009682 TTGTGGAATCAGATGTTGGATGG + Intergenic
925904947 2:8534829-8534851 CTGTGGAAGGAGCTGAGTCAGGG + Intergenic
926853656 2:17228563-17228585 CTGTGGAAGCAGCTGCTGGTTGG - Intergenic
927114742 2:19888966-19888988 GTGTGGAGGCAGATGGAGCAAGG - Intergenic
928337222 2:30408187-30408209 CCGTGGAAGGAGATGAGGCTGGG + Intergenic
928765658 2:34642205-34642227 CTGTGCAATCAGATGATGGTAGG - Intergenic
929416700 2:41749360-41749382 CTGTGGAAACAAATGATTCAGGG - Intergenic
929418657 2:41768936-41768958 CTGAGGAAGCTGGTGATACAGGG + Intergenic
930685344 2:54301884-54301906 CTGAGGAGGCAGATCAGGCAGGG + Intronic
931796623 2:65716680-65716702 ATTTGGAAGCAGATGATTCTAGG + Intergenic
931900200 2:66779992-66780014 CCCTGGAAGCAGATGTTGCTAGG - Intergenic
932000941 2:67883851-67883873 ATGTGGGAGCTGATGATCCATGG - Intergenic
932482296 2:72051714-72051736 CTCTGGAAGGAGGTGATGGAAGG - Intergenic
936084871 2:109460476-109460498 CTGTGGATGGAGGTGATGCATGG - Intronic
937499300 2:122461141-122461163 CTGTGGAAGCAGATGCGTCAAGG + Intergenic
939047050 2:137262028-137262050 CTGTAAAAGCTGAGGATGCAAGG + Intronic
939958368 2:148545547-148545569 CTGTGGAAGCAGACAAGGCCAGG - Intergenic
941134968 2:161703859-161703881 CTGTTGAGGCAGATGTTGTAGGG - Intronic
941167873 2:162103013-162103035 CTGAGGAAGCTGATGCTGCATGG - Intergenic
941168727 2:162111710-162111732 CTGTGGGAGAAGATGACCCAAGG - Intergenic
943563655 2:189492346-189492368 ATGTGGAAGGAGACTATGCAAGG - Intergenic
944452491 2:199857191-199857213 CTGTGGAAGAAGTAGATACAGGG - Intergenic
945447385 2:209954299-209954321 CAGTGGAAACATATGATGTAAGG - Intronic
948130807 2:235599381-235599403 CTGGGGAAGTGGATGCTGCAGGG + Intronic
948481052 2:238250795-238250817 TTGAGGAAGCACATTATGCAAGG - Intronic
948773230 2:240263150-240263172 TTTTGCAAGCACATGATGCAAGG - Intergenic
949061237 2:241958908-241958930 CTGTGGAAGTTGCTGATGCCAGG + Intergenic
1169561278 20:6803250-6803272 CAGTGGAGGCAGCTGTTGCATGG - Intergenic
1170307975 20:14960451-14960473 CTGTGGAAGCTGACCAGGCAAGG - Intronic
1170498526 20:16950686-16950708 CTGTGCCACCAGCTGATGCAGGG - Intergenic
1170585192 20:17729141-17729163 CTGTGGAAACAGAAAATTCATGG + Intronic
1170974301 20:21147991-21148013 GTGTGGCAGCAGATGAAGGAAGG + Intronic
1172212011 20:33206686-33206708 CTCTGGAGGCAGAGGTTGCAGGG - Intergenic
1172546336 20:35764576-35764598 CTGTGAAAGGACATGATGAAAGG - Intergenic
1172745422 20:37204032-37204054 CTGTAGTAACAGATCATGCATGG - Intronic
1173632665 20:44528339-44528361 CTGGGGAGGCAGAGGCTGCAGGG + Intergenic
1173904756 20:46618258-46618280 CAGTGGAAGCATATGAACCAAGG - Intronic
1175296493 20:57912412-57912434 CCTTGGAAGCAGATGGTGCCAGG - Intergenic
1175522378 20:59610177-59610199 CTGGGGAAGCAGAGGTTGCATGG + Intronic
1177938174 21:27376074-27376096 CTCTGGAAGTAGATGATGTAAGG + Intergenic
1178219914 21:30644594-30644616 CTGTGTAAGCAGCCAATGCAAGG + Intergenic
1178881319 21:36452481-36452503 CAGAGGAAACAGATGATTCAGGG - Intergenic
1179772016 21:43627580-43627602 CTATGGAATCAGATTATCCAGGG + Intronic
1180710326 22:17835217-17835239 TTGTGAAACCAGCTGATGCACGG - Intronic
1182746239 22:32607581-32607603 AGGTGGAAGGAGGTGATGCAGGG - Intronic
949133410 3:533555-533577 ATGTGGAAGCAACTGATGAATGG + Intergenic
950036157 3:9887393-9887415 ATGTGGAAGCAGGTGATCCTTGG + Intergenic
950465479 3:13150904-13150926 GTGTGAAAGCAGATGGTCCAGGG + Intergenic
950573032 3:13813787-13813809 AAGTGGGAGCAGATGCTGCAAGG - Intergenic
950789493 3:15461262-15461284 CTGTGGGACCAGATGGTGCTGGG - Intronic
951097513 3:18649134-18649156 CTCTGGAGGCAGAGGTTGCAGGG + Intergenic
951372158 3:21862768-21862790 CTGTGGCAGCAGATGTAACAGGG - Intronic
952292881 3:32035484-32035506 CTTGGGAGGCAGAGGATGCAGGG + Intronic
953775317 3:45811825-45811847 CTTTGGAAGGAGATGGTGCCTGG + Intergenic
954212130 3:49103828-49103850 CTGGGGAGGCAGACGATGCCTGG + Intronic
954500220 3:51006592-51006614 CTGTGGAAGCAGAGCTTGAAGGG - Intronic
955732449 3:62000863-62000885 CTGGGAAAGCAGATGATCCAGGG - Intronic
957325162 3:78681970-78681992 CAGTGGAGGCAGATAATGAATGG + Intronic
957875566 3:86141404-86141426 CGGTGGACTCACATGATGCAAGG - Intergenic
958018644 3:87971009-87971031 CTGTGGAAGGGGAGGAGGCAGGG - Intergenic
960659667 3:120043909-120043931 TTGTAGAAGCAGATGATCTAAGG + Intronic
961574604 3:127824040-127824062 GTGTAAAAGCAGATGGTGCATGG + Intergenic
962177512 3:133169548-133169570 TTGTGGAAGGAGATGCTGCCAGG + Intronic
962655689 3:137542238-137542260 CTGTGGCAGCACAGGGTGCAGGG + Intergenic
964477802 3:157112192-157112214 CTGTTGAAGGAGATGAGGCAGGG + Intergenic
964833010 3:160906855-160906877 CTGTGGAAGCTTATGTGGCAAGG - Intronic
964913964 3:161816981-161817003 CATTGAAAGCAGATGATTCATGG + Intergenic
965513053 3:169590411-169590433 CTGTGGGAGCAGATTTTGCCAGG - Intronic
966876103 3:184322635-184322657 CTGAGGAAGCAGATGAGACCTGG + Exonic
969180092 4:5433668-5433690 CTGTGGAAACAGATCCTGGAAGG + Intronic
969393556 4:6906794-6906816 CTGGGGAGGCAGAGGTTGCAGGG - Intergenic
969648231 4:8446506-8446528 CTTTGGAAGAAGATGATGAGGGG + Exonic
970708945 4:18839238-18839260 CCGGGGAGGCAGAGGATGCAGGG + Intergenic
971301589 4:25446550-25446572 CTGAGGGTGCAGATGAGGCAGGG + Intergenic
976213926 4:82697978-82698000 CTGTGGAAGAAGATAATGTGAGG + Intronic
979589251 4:122459689-122459711 CGGTGGTAGCTGATGATTCAAGG + Intergenic
983358536 4:166697699-166697721 CAGTTGAAGCAGATGATGTGAGG - Intergenic
985608466 5:872114-872136 TTGTGGAAGGAGACAATGCACGG - Intronic
986163841 5:5255568-5255590 CTCTGGAAGCAGTGGATGTAAGG - Intronic
986901796 5:12443862-12443884 CTGTGGTAGGAAATGAGGCAAGG - Intergenic
988342468 5:29991050-29991072 CTGTGGAGACAGATCATCCATGG - Intergenic
989098420 5:37802378-37802400 CTGTGGAAGTAGAAAAGGCAAGG - Intergenic
991631624 5:68661899-68661921 CAGTGGAGGCAGATGATGGCTGG + Intergenic
993852507 5:93028380-93028402 ATGTGAAGGCAGAAGATGCAAGG - Intergenic
995380526 5:111527378-111527400 CTGTGGTAGCAGCAGATGAATGG - Intergenic
995909009 5:117163305-117163327 CTGTAGAAGCAGAAGTTTCATGG + Intergenic
996775259 5:127125968-127125990 ATTTGGAGTCAGATGATGCAGGG - Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
998174477 5:139893528-139893550 CTGGGGAAGGAGCTGCTGCAGGG - Intronic
998306807 5:141085599-141085621 CAGTGGATGCTTATGATGCATGG - Intergenic
1000391691 5:160729193-160729215 CTCTGGAAGCTTATAATGCAAGG + Intronic
1002185056 5:177450546-177450568 CTATGGAAGGAGATGCTGGAGGG - Intronic
1002586773 5:180253477-180253499 CTATGGAGGCAGAAGAGGCAAGG + Intronic
1004997798 6:21210943-21210965 ATGAGGAAGCAGATGGGGCATGG - Intronic
1006185639 6:32180188-32180210 CTGTGGAAGCATATGCTCCTAGG - Intronic
1006630041 6:35424380-35424402 GTGTGGAAGCAGTTGGTGAATGG + Exonic
1008165727 6:48135880-48135902 ATGTGGAAGGGGATTATGCAAGG + Intergenic
1008844759 6:55950072-55950094 CTGTGAGTGCACATGATGCACGG + Intergenic
1010107561 6:72187567-72187589 CTCAGGAAGCAGAGGTTGCAGGG - Intronic
1010153018 6:72758454-72758476 CTGTAGCAGCAGATAATCCAAGG + Intronic
1010391436 6:75342780-75342802 CTGTGGAAATAGCTGAGGCAGGG - Intronic
1010524989 6:76890161-76890183 CTGTGAAAGAAGAGCATGCATGG - Intergenic
1012592913 6:101005180-101005202 CTGTGGGGGCACAGGATGCAAGG - Intergenic
1013007999 6:106092371-106092393 CTGTGGGAGCAGGTGAAGCAAGG + Intronic
1014893371 6:126870034-126870056 CTGTGAATGCAGATGATACTGGG - Intergenic
1015737129 6:136413084-136413106 CTTGGGAGGCAGAAGATGCAGGG + Intronic
1016683954 6:146860695-146860717 CTGTGGAAAAAGAGAATGCATGG - Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1018365935 6:163119920-163119942 ATGTGGAAGCAGAAAATGAATGG - Intronic
1018672950 6:166194631-166194653 CTGTGGAAGCAGATGCCTCCCGG + Intergenic
1019974595 7:4570576-4570598 CTGGGGATGCAGAGGTTGCAAGG + Intergenic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022675501 7:32495511-32495533 CTGCGGAAGCGGATGAGGGAAGG + Exonic
1023316726 7:38945141-38945163 ATGTTGAGGCAGAGGATGCAGGG + Intergenic
1024020341 7:45362640-45362662 CTAGAGAAGCAGATGCTGCAAGG + Intergenic
1024058949 7:45683964-45683986 CGGGGGAAGCAGATGATGGGAGG + Intronic
1024448388 7:49509441-49509463 CTATGGAAACAGCTGTTGCAGGG - Intergenic
1024737331 7:52319896-52319918 TGGTGGAAGCAGATGATAGATGG - Intergenic
1026181391 7:68044165-68044187 TTGTGGGAGCAAATGATGCTGGG - Intergenic
1028595035 7:92539146-92539168 CTCTGGAAGCAGCTGAAGAACGG + Intergenic
1028741215 7:94278052-94278074 GTATGGAAGCAGAAGTTGCAGGG + Intergenic
1028989796 7:97036764-97036786 CTGAGGAGGCAGAAGTTGCAGGG - Intergenic
1029005463 7:97204456-97204478 CTGTGGTAGAAGATGATTTATGG + Intergenic
1032447550 7:131997613-131997635 CTAGGGAAGCAGATCATGGAAGG - Intergenic
1032734270 7:134676494-134676516 CTCTGGAAACAGATAAAGCATGG + Intronic
1033657983 7:143386186-143386208 CCGGGGAAGCAGGTGATGGAGGG + Intronic
1034325066 7:150222256-150222278 CTGTGGATGCAGATGCTGGTTGG + Intergenic
1034405607 7:150900702-150900724 CAGAGGAATCAGAAGATGCAAGG - Intergenic
1036508729 8:9380869-9380891 CTGTGGTTGCAGAGGATGTATGG + Intergenic
1037762497 8:21751160-21751182 CTTAGGAAGCAGCTGGTGCAGGG + Intronic
1040418995 8:47221731-47221753 CTGTGGATGGTGATGATGCTGGG - Intergenic
1041541573 8:58990808-58990830 TTGTGGGAGCAGAAGATGGAAGG - Intronic
1042374611 8:68035757-68035779 CTGTGGTAGAAGATGGTGAAAGG + Intronic
1042721196 8:71828377-71828399 CCGGGGAAGCAGATGCTGCCCGG + Intronic
1043211814 8:77529045-77529067 CTATGGAAGGAGATGATTTAGGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1045003289 8:97896589-97896611 CAGTGGGATCAGATAATGCAGGG + Intronic
1045331394 8:101158643-101158665 CTGTGTATGCAGATGATGGATGG + Intergenic
1047084567 8:121502101-121502123 CTGAGGAAGGAGATGACGTAAGG + Intergenic
1047140074 8:122128501-122128523 CTGTAGAAGGAAAAGATGCAAGG + Intergenic
1047203589 8:122785807-122785829 CTGTGCAAAGAGATGATGCCAGG + Intronic
1047417776 8:124679557-124679579 CTCTAGAAGCAGATCAGGCAAGG - Intronic
1048757198 8:137752978-137753000 CAGTGAAAGCAGATGATGTAGGG + Intergenic
1048903238 8:139060531-139060553 CTGTGGAAGCAGAGATTGGAGGG - Intergenic
1049117660 8:140703340-140703362 CTGTAGAAGCTGATAAGGCAAGG + Intronic
1051014241 9:12456456-12456478 AGGAGGGAGCAGATGATGCAAGG - Intergenic
1053567845 9:39271605-39271627 CTGTGGGAACAGATGAGGCCTGG + Intronic
1053833852 9:42112552-42112574 CTGTGGGAACAGATGAGGCTTGG + Intronic
1054129298 9:61347394-61347416 CTGTGGGAACAGATGAGGCCTGG - Intergenic
1054596700 9:67074858-67074880 CTGTGGGAACAGATGAGGCTTGG - Intergenic
1055779139 9:79800354-79800376 CTGTGGAAGCTGATGGTGGTGGG + Intergenic
1055820422 9:80254986-80255008 CTCTGGAAGCAGAAAAGGCAAGG + Intergenic
1056512440 9:87318689-87318711 CTGGGCATGCAAATGATGCATGG + Intergenic
1059307410 9:113365573-113365595 CTGGAGAAGCAGCTGATTCAGGG - Intronic
1059336821 9:113574375-113574397 CTGTGGAAGTAGAGGCAGCAGGG - Intronic
1060176071 9:121498621-121498643 CTGAGGAAGCAGGAGATGTAGGG - Intergenic
1060231091 9:121826007-121826029 GTGTGGAAAGAGATGATGGAGGG + Intronic
1060628117 9:125131661-125131683 CTGTGAAAGCAGACTCTGCAGGG - Intronic
1062282757 9:135759335-135759357 CTCTGGGAGCAGGGGATGCAGGG - Intronic
1186399220 X:9241417-9241439 CTGCGTAAGAAGAGGATGCAAGG + Intergenic
1187221761 X:17334095-17334117 CTGTGTACTCAGATGATGGAAGG + Intergenic
1187239428 X:17499309-17499331 CTGTGTCAGCAAGTGATGCAGGG - Intronic
1187555540 X:20347858-20347880 CTGTGAAAGCAGAGGAGGAAGGG - Intergenic
1188734044 X:33690367-33690389 CTGTGGAAACTGTTGAAGCATGG - Intergenic
1188878917 X:35468288-35468310 CTGTGGAGGAAGAAGGTGCAAGG + Intergenic
1189290126 X:39878863-39878885 ATGTGAAATCAAATGATGCAGGG + Intergenic
1189446109 X:41083702-41083724 GTGGGGAAGCAAATGATTCATGG + Intergenic
1190409730 X:50124646-50124668 TTGTGGAAGCAGTTGTTGAAGGG - Intergenic
1193571179 X:83146296-83146318 CTATTGAAGCTGATGATTCAAGG + Intergenic
1195394507 X:104396865-104396887 AGGTGGAAACAGATCATGCAAGG - Intergenic
1195759257 X:108228322-108228344 CCTTGAAAACAGATGATGCATGG + Intronic
1195868167 X:109456097-109456119 CTGTAGAAACAGATCATGAATGG + Intronic
1195903231 X:109819763-109819785 CTGGGCAAGCAGATGATGTTTGG + Intergenic
1199649867 X:149940038-149940060 CTGTGGGAGCAGATGGGGCGGGG + Intergenic
1200236501 X:154470234-154470256 CACTGGAAGCAAATGATCCATGG - Intronic
1200742368 Y:6868142-6868164 CTGTGGCAGCAGGGGCTGCATGG + Exonic
1201235222 Y:11903063-11903085 CTGAGTAGGCAAATGATGCATGG - Intergenic
1201915719 Y:19179534-19179556 CTGTGGAAGCATATCATACCCGG + Intergenic
1202366689 Y:24170682-24170704 CCAGGGTAGCAGATGATGCAGGG - Intergenic
1202373715 Y:24214800-24214822 CCAGGGTAGCAGATGATGCATGG + Intergenic
1202497066 Y:25455320-25455342 CCAGGGTAGCAGATGATGCATGG - Intergenic
1202504093 Y:25499441-25499463 CCAGGGTAGCAGATGATGCAGGG + Intergenic