ID: 1128565649

View in Genome Browser
Species Human (GRCh38)
Location 15:68699156-68699178
Sequence TCTCACTGACCACCACCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 232}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128565649_1128565659 14 Left 1128565649 15:68699156-68699178 CCCTGGGGTGGTGGTCAGTGAGA 0: 1
1: 0
2: 2
3: 18
4: 232
Right 1128565659 15:68699193-68699215 GGGCAGCTGCGAAGGGCAGTTGG 0: 1
1: 0
2: 2
3: 31
4: 304
1128565649_1128565660 22 Left 1128565649 15:68699156-68699178 CCCTGGGGTGGTGGTCAGTGAGA 0: 1
1: 0
2: 2
3: 18
4: 232
Right 1128565660 15:68699201-68699223 GCGAAGGGCAGTTGGACCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 118
1128565649_1128565656 -6 Left 1128565649 15:68699156-68699178 CCCTGGGGTGGTGGTCAGTGAGA 0: 1
1: 0
2: 2
3: 18
4: 232
Right 1128565656 15:68699173-68699195 GTGAGAGGAGCGGGCAGGAAGGG 0: 1
1: 0
2: 2
3: 70
4: 802
1128565649_1128565655 -7 Left 1128565649 15:68699156-68699178 CCCTGGGGTGGTGGTCAGTGAGA 0: 1
1: 0
2: 2
3: 18
4: 232
Right 1128565655 15:68699172-68699194 AGTGAGAGGAGCGGGCAGGAAGG 0: 1
1: 0
2: 7
3: 72
4: 826
1128565649_1128565658 7 Left 1128565649 15:68699156-68699178 CCCTGGGGTGGTGGTCAGTGAGA 0: 1
1: 0
2: 2
3: 18
4: 232
Right 1128565658 15:68699186-68699208 GCAGGAAGGGCAGCTGCGAAGGG 0: 1
1: 0
2: 7
3: 64
4: 355
1128565649_1128565657 6 Left 1128565649 15:68699156-68699178 CCCTGGGGTGGTGGTCAGTGAGA 0: 1
1: 0
2: 2
3: 18
4: 232
Right 1128565657 15:68699185-68699207 GGCAGGAAGGGCAGCTGCGAAGG 0: 1
1: 0
2: 11
3: 62
4: 615
1128565649_1128565661 30 Left 1128565649 15:68699156-68699178 CCCTGGGGTGGTGGTCAGTGAGA 0: 1
1: 0
2: 2
3: 18
4: 232
Right 1128565661 15:68699209-68699231 CAGTTGGACCCAAGGAGAGAAGG 0: 1
1: 0
2: 1
3: 20
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128565649 Original CRISPR TCTCACTGACCACCACCCCA GGG (reversed) Intronic
900121392 1:1049977-1049999 TCGCACTGAGCACCACCCTCGGG - Exonic
900225922 1:1533642-1533664 CCTCACTGACCGCCGACCCAGGG - Intronic
900419119 1:2547988-2548010 CCTCACTGACAACCAGACCATGG + Intergenic
900856331 1:5187898-5187920 GCTCACTGAGAACCAACCCAAGG - Intergenic
902674517 1:17999463-17999485 TCCTCCAGACCACCACCCCACGG - Intergenic
903327469 1:22577624-22577646 TCTCACTGTCCTCCTCCACAAGG - Intronic
904206083 1:28856122-28856144 TCCCTCTTTCCACCACCCCAAGG - Intronic
905338371 1:37260774-37260796 TCTTACACACCACCACCCCACGG - Intergenic
905401809 1:37708990-37709012 TCCCACTGACCACCTCCCACAGG - Exonic
906746357 1:48224779-48224801 ACTCACTGGCCACCAGCTCATGG - Exonic
907230952 1:52997902-52997924 TCTCACTCTCCACCACCACCAGG + Intronic
907325634 1:53637146-53637168 TGTCAGTGCCCACCAGCCCAGGG - Intronic
908724696 1:67163109-67163131 TCTCAGTGTCCAGCACCTCATGG - Intronic
909843067 1:80354555-80354577 TCCCACTTTCCAACACCCCAAGG - Intergenic
910626272 1:89311552-89311574 TCACAGTGACCAGCAACCCATGG + Intergenic
913672284 1:121108320-121108342 TCTCACTGTCAACCAATCCAAGG - Intergenic
914024047 1:143895681-143895703 TCTCACTGTCAACCAATCCAAGG - Intergenic
914662538 1:149803712-149803734 TCTCACTGTCAACCAATCCAAGG - Intronic
915451013 1:156005138-156005160 TCTAACTGAAAACCACCCTAGGG - Intronic
915552325 1:156642304-156642326 TCTCCCTGTCCCCGACCCCACGG - Intronic
915635539 1:157183988-157184010 TCTCACTCAGCCCCAGCCCAGGG + Intergenic
915909895 1:159908455-159908477 TCTCACTGCCCAGCAAGCCAAGG + Intergenic
919703373 1:200653857-200653879 TCTCCCTGACTACCAATCCAAGG + Intronic
920187893 1:204173126-204173148 AGTCCCTGACCACCAACCCAGGG - Intergenic
921265365 1:213417061-213417083 TGGCACTTCCCACCACCCCAGGG + Intergenic
923861384 1:237895134-237895156 ACTGACTGACCCCCACCCAAAGG - Intergenic
1066201266 10:33144333-33144355 TCAGACTAACCACCACCCAATGG + Intergenic
1066438588 10:35416108-35416130 TGGCACTGAACAGCACCCCACGG - Intronic
1066585531 10:36930310-36930332 TCTCACTGACGACCTCCTCATGG + Intergenic
1067045149 10:42981262-42981284 TGACACTGTCTACCACCCCAGGG - Intergenic
1068274307 10:54773095-54773117 TCTCCCTGCCCCCCACCCCTTGG - Intronic
1069254814 10:66319410-66319432 TCTTACTGACCAACATCGCATGG - Intronic
1069559201 10:69417757-69417779 TCTCATTCACCAGCAACCCACGG + Intergenic
1070764191 10:79047192-79047214 TCCCACTGACCTCCACCCACTGG - Intergenic
1072081478 10:92037116-92037138 TCTCCCTCACCACCAATCCATGG + Intergenic
1072554043 10:96501231-96501253 TCTCCCTTTCCACCACCTCAAGG + Intronic
1073216389 10:101839116-101839138 TCCCAGTGATCACAACCCCAGGG + Intronic
1073855171 10:107664985-107665007 TCTCCCTGACCACAAAGCCAGGG - Intergenic
1074720667 10:116262404-116262426 TCTCACTGACCACTTCCTAAAGG - Intronic
1075712461 10:124537985-124538007 TCTGACTGAGCACTGCCCCAAGG + Intronic
1076134595 10:128036673-128036695 TCCCACTGACCACCACTGCCAGG + Intronic
1076828002 10:132979916-132979938 TGCCACTGACCATCACCACAGGG + Intergenic
1076893186 10:133295100-133295122 CCACACTAACCCCCACCCCACGG - Intronic
1077021565 11:419387-419409 TATCCCTGACCTCCAGCCCAGGG + Intronic
1077023075 11:428277-428299 GCTCTCTGACCACAGCCCCAAGG + Intronic
1079011657 11:16833525-16833547 ACTCACTTTCCACCTCCCCAGGG + Intronic
1080189025 11:29523442-29523464 TCTCACAGACCAACCCCTCAGGG + Intergenic
1081586794 11:44390657-44390679 TCTCAGTGATCACCACCTCCTGG - Intergenic
1082983182 11:59142957-59142979 TCTCACTGACCCCGTGCCCACGG - Intronic
1083171993 11:60928678-60928700 TCTCACAGGCCTCCACCACACGG + Exonic
1084004352 11:66315237-66315259 CCTCTCTGACCACCACCTCCAGG - Exonic
1085023393 11:73222761-73222783 ACTCCCTGACCACCTCCCCCAGG + Intronic
1086303883 11:85459490-85459512 TCTCAGGGAGCCCCACCCCAGGG + Intronic
1087081422 11:94174514-94174536 CTTCCCTGACCACCTCCCCAGGG + Intronic
1088509784 11:110562426-110562448 TCTGTCTGCCCCCCACCCCAGGG - Intergenic
1089945525 11:122468407-122468429 TCTCCCAGACCACATCCCCAAGG - Intergenic
1092368164 12:7894311-7894333 GCTCACTGACCTCCACCTCCCGG - Intergenic
1093607952 12:21117182-21117204 ACTCAATGAACACTACCCCAAGG - Intronic
1093991347 12:25592612-25592634 TCTGACTGCCCCCCGCCCCAAGG - Intronic
1095542413 12:43325901-43325923 ACACACTGCCCACCACACCAAGG - Intergenic
1095559578 12:43550640-43550662 ACTCCCTGATCACCACTCCAGGG + Intronic
1100019317 12:90050302-90050324 ACTCACTCCCCACCACCCCCAGG - Intergenic
1102629276 12:114263172-114263194 TGGCTCTGACCACCATCCCAAGG - Intergenic
1104715426 12:131013056-131013078 TCACACTGGGCACGACCCCAAGG - Intronic
1105806035 13:23952024-23952046 CCTTTCTGACCACCACCCCCAGG - Intergenic
1106105440 13:26728899-26728921 CCTCACTGACCTCCTCCCCCAGG - Intergenic
1106252391 13:27992293-27992315 TCCCACTCACCACGACCCCTGGG - Intergenic
1108922265 13:55691162-55691184 TGTCACTGCACTCCACCCCAGGG - Intergenic
1112813926 13:103250800-103250822 GCTGACTGAACCCCACCCCACGG - Intergenic
1114399110 14:22393230-22393252 TCTCACTGTCAATCATCCCAGGG - Intergenic
1119319987 14:73724900-73724922 TCTCAGTGGCCTTCACCCCAGGG + Intronic
1119650371 14:76378764-76378786 TCTTTCTGACCTCTACCCCATGG + Intronic
1119732620 14:76960635-76960657 GCTCACTGACCTCCACCTCCTGG + Intergenic
1120592814 14:86395461-86395483 ACTCACTCACCCCCTCCCCAGGG + Intergenic
1124660486 15:31546488-31546510 TCAAACTGTCCCCCACCCCAAGG + Intronic
1124662384 15:31560830-31560852 CCACACTGACCAGCACACCACGG + Intronic
1126116386 15:45211442-45211464 TCTCACTTACAACCTCCTCAAGG - Intergenic
1126663747 15:51056812-51056834 TCTCTCTCCCCACCCCCCCATGG + Exonic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1128364594 15:66988743-66988765 TCTCTTTGACCACCACCACTAGG - Intergenic
1128451691 15:67809572-67809594 TCTCTTTGACCAGCTCCCCAGGG + Intergenic
1128565649 15:68699156-68699178 TCTCACTGACCACCACCCCAGGG - Intronic
1129557935 15:76532835-76532857 TCTCACTTCCCACCTCCCAAAGG - Intronic
1130033744 15:80339796-80339818 TCTCAGAGGCCTCCACCCCAGGG - Intergenic
1130608782 15:85341625-85341647 CCTCACTTTCCATCACCCCATGG - Intergenic
1132522663 16:398669-398691 GCTCAGGGACCACCACCGCAAGG - Intronic
1132728492 16:1349073-1349095 TCACACTGACCACCAGCCTTGGG - Exonic
1133130149 16:3671774-3671796 CCTCACTGTCCACCACACCTGGG + Exonic
1133297895 16:4764191-4764213 TCACACTGACCACCTCTCAAGGG - Intronic
1133873209 16:9708910-9708932 TCCCACTGCCCCCCACCCCATGG - Intergenic
1134507791 16:14822299-14822321 TATCACCCACCACCAACCCAGGG - Intronic
1135838796 16:25854751-25854773 CCTCCCTTACCACCACACCAAGG - Intronic
1136118610 16:28112988-28113010 TCTCACTGGCCACCACCGTGCGG - Exonic
1136402540 16:30026438-30026460 GTTCACTGAGCACCAGCCCAGGG - Intronic
1137501895 16:49018247-49018269 CCTCACTGACCTCATCCCCAAGG + Intergenic
1138455251 16:57117231-57117253 CATCTCTGCCCACCACCCCATGG + Intronic
1138989449 16:62373623-62373645 TCTCACTGACCCCCAACACCTGG + Intergenic
1140871216 16:79108392-79108414 TCTACCTGACCACCCCTCCAGGG + Intronic
1141763234 16:86042898-86042920 CCTCACTGCCCCCCACCCCAGGG + Intergenic
1142684868 17:1571937-1571959 CCTCACTGATCAAAACCCCAAGG + Intronic
1142872053 17:2827478-2827500 TCTTCCTGACCACCCACCCAGGG - Intronic
1142955140 17:3516416-3516438 CCCCAAAGACCACCACCCCAGGG + Intronic
1143022266 17:3922988-3923010 TCACACCTACCACCTCCCCAGGG - Intergenic
1143046055 17:4080761-4080783 GCTCACTGACAACCACTACAAGG + Intronic
1143163762 17:4887265-4887287 TCTCTGTGCCCACCACCCCCAGG - Intronic
1143862006 17:9897821-9897843 TCCCTCTGTCCACCAGCCCATGG - Exonic
1146915214 17:36673940-36673962 TCTCAGAGACCCCCACCCCCAGG - Intergenic
1149982914 17:61325532-61325554 TCACACTGAATTCCACCCCATGG + Intronic
1150733992 17:67719690-67719712 TTTCACTGACCAGCTCCCCAAGG - Exonic
1151656581 17:75499038-75499060 TCTCATTGGTCACCACCACAAGG - Exonic
1152268103 17:79308008-79308030 TGTCCCTGTCCACCACCTCATGG + Intronic
1152842401 17:82578671-82578693 TCTCCCTGACAACAACTCCAAGG - Intronic
1153089926 18:1331645-1331667 TATCACTCACCATCACCCCTAGG + Intergenic
1153515010 18:5894900-5894922 TCTCACCGAACACCAGCCCGGGG + Intronic
1155253933 18:23978400-23978422 TCTCACTTACCCCCACCCAGAGG + Intergenic
1155935330 18:31747272-31747294 CACCCCTGACCACCACCCCAGGG + Intergenic
1158452625 18:57580732-57580754 TCCCACTGCACCCCACCCCACGG + Intronic
1159039177 18:63306990-63307012 TCTCACTTCCCACTTCCCCAGGG + Intronic
1160367706 18:78342680-78342702 CCTCACTCCCCACCACCTCATGG + Intergenic
1160456517 18:79006079-79006101 CCTCAGTGACCCCGACCCCAAGG + Intergenic
1161087250 19:2340826-2340848 TCCCACTGCCCACCACCCTTGGG - Intronic
1161604154 19:5205435-5205457 CCCCACCGACCTCCACCCCAGGG + Intronic
1162568790 19:11458750-11458772 TCTGACTCAGCCCCACCCCACGG - Intronic
1163324884 19:16596994-16597016 TCTCACAGACCACGCCCACATGG + Intronic
1163370673 19:16899609-16899631 TCCCACTGACCACTGCCCCCAGG - Intronic
1163818742 19:19483996-19484018 TCTGAGTGAACACCACCCCTTGG + Intronic
1165228836 19:34373312-34373334 TCTCAGTAACCTCCACCTCATGG - Intronic
1166251305 19:41572848-41572870 TGTCAGTGACAACCACCCCATGG - Intronic
1166718976 19:44986736-44986758 TCTCCCACACCACCACCCCTGGG + Intronic
1166795758 19:45424414-45424436 TCCCCCTGACCCCCATCCCACGG - Intronic
1167793221 19:51693206-51693228 CATCTCTGACCCCCACCCCAGGG + Intergenic
1167854387 19:52226148-52226170 TCTCACTGTCCACCTCCCAACGG + Exonic
1168200531 19:54812159-54812181 TATCACTCACCATCACTCCAGGG + Intronic
1168297663 19:55385259-55385281 TCTCGCTGACTGCCACCCCAGGG - Intergenic
925271257 2:2609392-2609414 TCTCACTGGCCACAAACCCTGGG + Intergenic
926974650 2:18502403-18502425 TCTCACTGAGCACCTCCCAATGG + Intergenic
927034401 2:19158696-19158718 TCACAATCACCACCACCCCAGGG - Intergenic
927107918 2:19843765-19843787 TCTCAGTCCCCACCAGCCCATGG + Intergenic
929498132 2:42464725-42464747 GCTCAAGGATCACCACCCCAGGG + Intronic
929592072 2:43153920-43153942 ACTCCCTGACCACCCACCCATGG - Intergenic
929959582 2:46486318-46486340 TCTCTCTCACCTCAACCCCATGG - Intergenic
931779369 2:65566092-65566114 TCACGCTGACCAGCATCCCAGGG - Intergenic
932604534 2:73156426-73156448 TTTCCCTGACCGCCACCACACGG + Intronic
934188727 2:89766749-89766771 TGCCCCTGCCCACCACCCCATGG + Intergenic
936042685 2:109161770-109161792 GCTCACTCACCACCACCCCCAGG + Intronic
937232634 2:120407029-120407051 CCTCCCTGACCCACACCCCATGG - Intergenic
937924536 2:127157737-127157759 TCTCACTGCCCTCCAGCCCCGGG - Intergenic
940664915 2:156597032-156597054 TCTCCCTACCCACCAGCCCATGG + Intronic
941069190 2:160937432-160937454 TCCCACTCAACACAACCCCACGG - Intergenic
944709261 2:202321050-202321072 TCTCCCTCACCACCATCCCACGG + Intergenic
944913056 2:204328944-204328966 TCTTACTGTCCACGACCCCCAGG - Intergenic
946175588 2:217920185-217920207 TGTCACTCACCACCAGCTCATGG + Exonic
946192838 2:218016469-218016491 TCTCACTGGGCTCCTCCCCAGGG + Intergenic
946466519 2:219916875-219916897 AATTCCTGACCACCACCCCAGGG + Intergenic
947335859 2:229082363-229082385 ACTCACTGACCTTTACCCCATGG + Intronic
948711937 2:239830674-239830696 TCTCACTGCCAAACACCTCAGGG + Intergenic
948861072 2:240752808-240752830 CCTCTCCGAGCACCACCCCATGG - Intronic
948907255 2:240985852-240985874 TCTCACTGCCCCCCACAGCAGGG + Intronic
1171248740 20:23633412-23633434 TCTCCCTGACCCCCTCACCAGGG + Intronic
1171255245 20:23685390-23685412 TCTCCCTGACCCCCTCGCCAGGG + Intergenic
1171262581 20:23747312-23747334 TCTCCCTGACCCCCTCACCAGGG + Intergenic
1171283172 20:23918292-23918314 TCTCCCTGACCCCCTCACCAGGG + Intergenic
1172996850 20:39077162-39077184 TCTGCCTGTCCACCACTCCAGGG + Intergenic
1174358558 20:50014290-50014312 TATCACTCACCACCACCTCCAGG - Intergenic
1174531501 20:51217994-51218016 CCCCACTCACCATCACCCCAAGG + Intergenic
1179051185 21:37889696-37889718 TCTCACTGGCCAGCAACCCTTGG + Intronic
1179548282 21:42126478-42126500 TCTCCCTTACCCCCACTCCAGGG - Exonic
1180534951 22:16388286-16388308 TGCCCCTGCCCACCACCCCACGG - Intergenic
1181951133 22:26554552-26554574 CCCCACTGACCCCCAACCCAGGG - Intronic
1182721536 22:32405050-32405072 TCCCCCTCACCCCCACCCCAGGG - Intronic
1183434209 22:37783862-37783884 TGTCCCTGGCCCCCACCCCAGGG + Intergenic
1185154401 22:49184366-49184388 TCTCCCTGAGCACCTCACCACGG - Intergenic
1185156378 22:49195768-49195790 TCTCTCTGAGCACCTTCCCAAGG - Intergenic
1185392555 22:50570517-50570539 GCTCCCTGGCCACCACCCCGTGG + Intronic
950183790 3:10932895-10932917 CCTCACTTTCCAGCACCCCAAGG - Intronic
951598305 3:24342416-24342438 GCTGAATGACCCCCACCCCAGGG - Intronic
952919176 3:38273195-38273217 CTTGACTGACCCCCACCCCATGG - Intronic
954784850 3:53085178-53085200 TCTCACTGCCCACCAGCCTGAGG + Intronic
954907007 3:54071585-54071607 TCACACTTACCACCACCCCATGG + Intergenic
955149305 3:56351043-56351065 TCTCCCTCTCCTCCACCCCAGGG - Intronic
958720158 3:97834014-97834036 AATCACTCACCACCACTCCAGGG + Intronic
961654790 3:128435311-128435333 TCTCACTGCCCTCTCCCCCAGGG + Intergenic
962196596 3:133369113-133369135 TCCCACTGACCCCAAGCCCATGG + Intronic
964621367 3:158722981-158723003 CCTCGCTGTGCACCACCCCATGG + Intronic
968378940 4:71959-71981 ACTCAATGACCACCCTCCCAAGG - Intronic
969670041 4:8585105-8585127 TCTCACTGCCGCACACCCCACGG - Intronic
970520448 4:16878569-16878591 TCTCTCAGACCACCACCAAAAGG + Intronic
972310803 4:37880131-37880153 TCTCACTGACCAGCATCGGATGG - Intergenic
974261232 4:59526893-59526915 TTTCACTGACTGCAACCCCAGGG - Intergenic
978446615 4:108786604-108786626 TCTCAGTGACCACGACTCAAAGG + Intergenic
978984910 4:114999882-114999904 CTTCACTGATCACCTCCCCAAGG - Intronic
982456823 4:155619748-155619770 TCTCTCCCACCACCACCCCGAGG - Intergenic
983955941 4:173698806-173698828 TCTCTCTGACTTCCAGCCCAGGG - Intergenic
986830906 5:11577032-11577054 TCTCACTGACAATGACCACAGGG + Intronic
988027949 5:25724297-25724319 TCTCTCTGACCACCACCACATGG + Intergenic
989100615 5:37819357-37819379 TCTCAGTGCCCACCTCCCCTGGG + Intronic
992615287 5:78541330-78541352 ACTCACTGACCAAGGCCCCATGG + Intronic
992748128 5:79838616-79838638 TCCCCCTGTCCCCCACCCCAGGG + Intergenic
995422225 5:111980688-111980710 TCTCCCTGACCTCCTACCCAAGG + Intronic
995512970 5:112926314-112926336 GCTCACTGACCTCCACCTCCTGG + Intergenic
995853279 5:116569377-116569399 CCTCTCTGACCTCCACCCCTTGG - Intronic
997209544 5:132069407-132069429 GCTCCCTGTCCCCCACCCCATGG + Intergenic
999204155 5:149836380-149836402 TCTCACTCAAGGCCACCCCAGGG + Exonic
1000053053 5:157578518-157578540 TGTCACAGTCCCCCACCCCAAGG + Intergenic
1000893320 5:166825412-166825434 TCTCACTGAGCACCACACTGGGG + Intergenic
1001596962 5:172904701-172904723 GCTCACCCACAACCACCCCATGG - Intronic
1001879819 5:175233626-175233648 TCTCTCTGACCTCCAGCACAGGG + Intergenic
1002906021 6:1449826-1449848 CCTCACAGCCCACCACACCAAGG + Intergenic
1004224612 6:13774170-13774192 CCTCCCTGGCAACCACCCCAGGG - Intergenic
1005365029 6:25067994-25068016 TCTCATCCACCACCACCCAAGGG + Intergenic
1010265330 6:73859374-73859396 CTTCACTGCCCCCCACCCCAAGG + Intergenic
1013759918 6:113506103-113506125 TCTCACTGACTAGCACAACAGGG + Intergenic
1015065941 6:129027745-129027767 TCTCACTTCCCACCTCCCCTGGG - Intronic
1016293588 6:142550410-142550432 TTTCCCTGACCACAACTCCAGGG - Intergenic
1017120551 6:151019974-151019996 TCTCACTGCCCAGCACCCAAGGG - Intronic
1017507292 6:155080276-155080298 TCCCACTGACAACCAGTCCAAGG - Intronic
1019586395 7:1806509-1806531 TCTCAGTGACCACCACTGTATGG + Intergenic
1021195555 7:17670577-17670599 TCTCACTGACCTCAATCTCATGG - Intergenic
1025273667 7:57552282-57552304 TCTCCCCTCCCACCACCCCAAGG - Intergenic
1031399991 7:121317856-121317878 TCTATCTGACCACCAGGCCAAGG + Intergenic
1033814643 7:145057162-145057184 TCTCACTCTCCAGCACCCCAAGG - Intergenic
1036888882 8:12581923-12581945 TCTCACTTACCAACACACCCTGG + Intergenic
1038387116 8:27159175-27159197 TCCCAGTGACCACCTCCCTATGG + Intergenic
1038855215 8:31323798-31323820 TCTCCCTGCCCCCAACCCCACGG + Intergenic
1041759553 8:61349504-61349526 TCTCACTGTTCCCCACCTCAGGG - Intronic
1046255867 8:111695012-111695034 TCTCACTCACCATTTCCCCATGG + Intergenic
1048610074 8:136012562-136012584 TCTCACTGAACACCAGAGCAGGG - Intergenic
1049242699 8:141546451-141546473 ACACACTAAGCACCACCCCATGG - Intergenic
1051289684 9:15532780-15532802 TCTCAGCAACCACCACCCCAGGG + Intergenic
1055380069 9:75697082-75697104 GCTGAATGACCACCACCCCCTGG + Intergenic
1056740595 9:89251202-89251224 TCTCTCTGCCCACCCTCCCATGG + Intergenic
1060965129 9:127707936-127707958 ACTCAGTGAGCACCAGCCCATGG - Intronic
1062086288 9:134650637-134650659 TCTGACTGGCCACCGCCCCATGG - Intronic
1062257712 9:135636671-135636693 CCTCCCTCACCTCCACCCCATGG + Intronic
1062521011 9:136957946-136957968 TGTGTCTGACCCCCACCCCAGGG - Intergenic
1203625357 Un_KI270750v1:12923-12945 TCTCCCCTCCCACCACCCCAAGG - Intergenic
1186267293 X:7844609-7844631 TCCCCCTGACCTCAACCCCACGG - Intergenic
1189388197 X:40554667-40554689 TCACCGTGACCACCACACCAAGG + Intergenic
1192212613 X:69137326-69137348 TCCCACTCTCCCCCACCCCAAGG + Intergenic
1193440882 X:81538102-81538124 TCTCACTCACCACTTTCCCAAGG + Intergenic
1194036980 X:88887022-88887044 CCTCTCTGGCCACCACCCCTGGG + Intergenic
1194847207 X:98825301-98825323 TCTCACTGAATAGCATCCCATGG + Intergenic
1196606518 X:117663379-117663401 TCTCAGTGCCCACCAACCCTGGG + Intergenic
1198431496 X:136571134-136571156 TTTCCCTGCCCACCACCTCAGGG - Intergenic
1198635227 X:138690733-138690755 TCTCACCCACCCCCATCCCAAGG + Intronic
1199667782 X:150114537-150114559 TTTCACTGACCAGCTCCCCAAGG - Intergenic
1199982643 X:152929275-152929297 GCTGTCTGACCCCCACCCCAGGG - Intronic
1200111072 X:153741138-153741160 TGCCCCTGCCCACCACCCCATGG - Intronic
1200911345 Y:8534132-8534154 TTTCACTGACCCCCACCCCTAGG + Intergenic
1200913444 Y:8550961-8550983 TTTCACTGACCCCCACCTCTGGG + Intergenic
1202182042 Y:22147942-22147964 TTTCACTGACAACCACCTCTGGG - Intergenic
1202209318 Y:22438460-22438482 TTTCACTGACAACCACCTCTGGG + Intergenic
1202590609 Y:26479453-26479475 TCTCCCCTACCCCCACCCCATGG - Intergenic