ID: 1128570798

View in Genome Browser
Species Human (GRCh38)
Location 15:68731454-68731476
Sequence GAGATAGGAGTGGCCCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128570790_1128570798 14 Left 1128570790 15:68731417-68731439 CCGGGAAACGGTGGGGGCTGGTG No data
Right 1128570798 15:68731454-68731476 GAGATAGGAGTGGCCCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128570798 Original CRISPR GAGATAGGAGTGGCCCAGCC TGG Intergenic
No off target data available for this crispr