ID: 1128580751

View in Genome Browser
Species Human (GRCh38)
Location 15:68808004-68808026
Sequence GTGAACAATCCCATGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128580746_1128580751 5 Left 1128580746 15:68807976-68807998 CCAAGTGTGATGAGCAGAACGTG 0: 1
1: 0
2: 1
3: 6
4: 89
Right 1128580751 15:68808004-68808026 GTGAACAATCCCATGGTGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128580751 Original CRISPR GTGAACAATCCCATGGTGGT GGG Intronic
903994880 1:27299530-27299552 GTGAACAAAGGCATGGGGGTGGG + Intronic
904914518 1:33960228-33960250 GAGACCCATCCCATGGGGGTGGG - Intronic
908198993 1:61774534-61774556 GTGAAGAATCTAATGGTGGTAGG - Intronic
911196601 1:95001263-95001285 GTGAAAAAACCCATGGGGGCTGG - Intronic
912632562 1:111258512-111258534 TCAAACAACCCCATGGTGGTTGG - Intergenic
914445141 1:147743978-147744000 ATGAACATCACCATGGTGGTAGG - Intergenic
922129882 1:222767078-222767100 CTTAACAATCCCATTGTTGTAGG - Intergenic
922295795 1:224248902-224248924 GGGTACAATCCCATGGGAGTGGG + Intronic
922621853 1:226994737-226994759 GAGGCCAATCCCAAGGTGGTGGG + Intronic
923623201 1:235594511-235594533 GTGCAGGAGCCCATGGTGGTGGG + Intronic
924452532 1:244191018-244191040 GTAAATAATCCCACTGTGGTGGG + Intergenic
1064481486 10:15744692-15744714 GTTAACAATCCCCTTGTGCTTGG + Intergenic
1065452907 10:25877431-25877453 GTGAACAATCAAATTGTGGAAGG + Intergenic
1069660429 10:70120022-70120044 CTGAGCAGCCCCATGGTGGTGGG - Intronic
1070723920 10:78775180-78775202 TGGCAGAATCCCATGGTGGTGGG - Intergenic
1070847362 10:79534264-79534286 TTTAACAATCGCCTGGTGGTTGG + Intergenic
1081612528 11:44571125-44571147 GTGAACAATGCCCTGGTAGTTGG + Intronic
1088245078 11:107809990-107810012 GTGAACTATCCCATGACTGTTGG + Intronic
1088899155 11:114102088-114102110 GTGAACACATCGATGGTGGTTGG + Intronic
1092950234 12:13496153-13496175 GTGTACAATCCCCTGTTGCTTGG + Intergenic
1093440638 12:19191841-19191863 GTGACCCATGACATGGTGGTTGG + Intronic
1095372375 12:41484521-41484543 GTGAAAAACCTCATTGTGGTGGG - Intronic
1095903686 12:47355323-47355345 GTGAACAATACCTGGGTGATGGG - Intergenic
1097156629 12:57016602-57016624 GTCACCAATCCCAGGGTGGCTGG + Intronic
1098015935 12:66104583-66104605 GTGAATAATCCCACGGTGTGGGG + Intergenic
1098147345 12:67511124-67511146 CTGAAGAAACCCATGATGGTGGG - Intergenic
1099058991 12:77882280-77882302 GTGGATAATCACATGGTTGTAGG - Intronic
1100765942 12:97865797-97865819 GTGAACATTCCCATGGGCTTGGG - Intergenic
1102220166 12:111188799-111188821 GTGAACGCACCCATGGTTGTTGG + Intronic
1103263212 12:119607383-119607405 GACAACAATCCCTTGGAGGTAGG - Intronic
1107448184 13:40486471-40486493 CAGAACATTCCCATGGTGCTGGG - Intergenic
1112041102 13:95548982-95549004 TTGAACAACCCCAGGGTGGGGGG + Intronic
1114498522 14:23151187-23151209 ATAAACAATCCCCTGGTGGCTGG + Intronic
1116311045 14:43326884-43326906 GTGCAGGAGCCCATGGTGGTGGG - Intergenic
1120957080 14:90092290-90092312 GTGAACAACTCCATGTTGATTGG + Intronic
1122008707 14:98728054-98728076 GGCAACAATCCCCTGGTTGTGGG - Intergenic
1122350052 14:101083873-101083895 ATCAACAATCACATGGGGGTTGG + Intergenic
1126068775 15:44847457-44847479 GTGAAAAAGCCCATGGTGCTGGG - Intergenic
1126090051 15:45043340-45043362 GTGAAAAAGCCCATGGTGCTGGG + Exonic
1127231093 15:56996345-56996367 GTCAACAATCAGATGGTTGTAGG - Intronic
1128580751 15:68808004-68808026 GTGAACAATCCCATGGTGGTGGG + Intronic
1131090956 15:89624719-89624741 GTCACCAATGCCATGGTGTTCGG - Exonic
1138758727 16:59518521-59518543 CTGAACAATCCCTGGGGGGTAGG + Intergenic
1139094174 16:63684668-63684690 ATGAACTAGCACATGGTGGTGGG - Intergenic
1139783001 16:69367161-69367183 GTCATCATTCCAATGGTGGTTGG + Exonic
1140189757 16:72805338-72805360 GTGAGCAATGCCAAGGCGGTAGG - Intronic
1140553361 16:75892357-75892379 GGAAACAAGCTCATGGTGGTAGG - Intergenic
1141583206 16:85014786-85014808 GAGAACATTCCCAAGGTGGTTGG + Intergenic
1143347312 17:6259451-6259473 GTGAATAATCCCATGTTGTATGG + Intergenic
1144422235 17:15109271-15109293 GAGAACAATCCCAAGGGAGTTGG + Intergenic
1146959800 17:36964356-36964378 GTGGACCATCTCATGGTGGCGGG + Intronic
1150965938 17:69968371-69968393 GTGTAAAATCTAATGGTGGTGGG + Intergenic
1151636491 17:75352489-75352511 GTGTACAATCCCATGATTCTGGG + Intronic
1152140483 17:78533616-78533638 CTGGAGAATCCCAAGGTGGTCGG + Intronic
1152331832 17:79677910-79677932 GAGCACAATCCCAGGGAGGTTGG + Intergenic
1152562713 17:81086612-81086634 GTGAGCAGTCCCAAGGTGGCAGG - Intronic
1157675769 18:49567565-49567587 GTCAATAATACCAGGGTGGTGGG + Exonic
1160393352 18:78554300-78554322 GTGAACAAACCAGTGGTTGTAGG + Intergenic
1163687132 19:18718038-18718060 GTGAACAGTTCCATGGCGTTTGG + Intronic
1166590705 19:43995620-43995642 GTGATCAATCCCAAAGTGCTGGG + Intronic
1168647552 19:58070163-58070185 GTCAAAACTCCCATGCTGGTAGG + Intronic
927476430 2:23417777-23417799 CTGAACAAGCCCACGGTGTTGGG - Intronic
928880613 2:36092521-36092543 GTGCAGGAGCCCATGGTGGTGGG - Intergenic
929654093 2:43712357-43712379 GTGAGCAATCCCTTCATGGTGGG - Exonic
933694199 2:85204406-85204428 GTAAGCATTCCCATGTTGGTAGG + Intronic
938128221 2:128689916-128689938 GGGAGCAATCCAGTGGTGGTGGG - Intergenic
940031880 2:149272257-149272279 GTGAGGAATCCAACGGTGGTAGG + Intergenic
941463307 2:165795309-165795331 GTGTTTAATCACATGGTGGTAGG + Intergenic
946074565 2:217063374-217063396 GAGAAGAATCCCTTGGTGATAGG + Intergenic
1173073719 20:39795620-39795642 GTGAGCAAAAGCATGGTGGTAGG - Intergenic
1173295998 20:41757911-41757933 GTGAAAAATCAGATGGTTGTAGG + Intergenic
1174230329 20:49040980-49041002 GTGAGCACTCCCATGCTGGAAGG - Intergenic
1175175294 20:57108211-57108233 GTGAGAAATGCCATGGTGGCTGG - Intergenic
1175777610 20:61663051-61663073 GTCATCAATACCATGGTGGAGGG - Intronic
1178304895 21:31483223-31483245 GTGCTTGATCCCATGGTGGTGGG - Intronic
1181933561 22:26423183-26423205 CTGAGCAGTACCATGGTGGTTGG - Intergenic
1182896862 22:33866133-33866155 GTTAACTACCCCATGGTGGATGG + Intronic
955150738 3:56364453-56364475 GTGAACAATTCAATGGTTTTTGG - Intronic
955451987 3:59078485-59078507 GTGATCCATCCCATGGAGGGAGG - Intergenic
955664120 3:61332317-61332339 CAGAACCATCCCATGGTGGGTGG + Intergenic
960681647 3:120254154-120254176 GTCAACAGTCAGATGGTGGTAGG - Intronic
962255965 3:133870470-133870492 GTGAACAATGCAGAGGTGGTGGG + Intronic
965474707 3:169141427-169141449 ATGAACACTCCCATTGTGGGAGG - Intronic
980665672 4:135930627-135930649 GTCAAAAATCAGATGGTGGTAGG - Intergenic
990607829 5:57428014-57428036 GTGAATGATCCCAGGGTTGTGGG + Intergenic
990633736 5:57699399-57699421 CTGCACATTTCCATGGTGGTGGG + Intergenic
994750903 5:103735773-103735795 GTGAAACATCCCGTGGTGGAAGG + Intergenic
995267550 5:110181037-110181059 GTGAACAGAACCATTGTGGTTGG + Intergenic
996447580 5:123573570-123573592 TTGAACAATTACATGGTTGTTGG + Intronic
1001345100 5:170887804-170887826 GTGCATTATCCCATGGTGGGAGG + Intronic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1006611560 6:35297292-35297314 CTTAACATTACCATGGTGGTGGG - Intergenic
1007041506 6:38726621-38726643 GTGAGCAAAGCCATGGTGGAGGG + Intronic
1007151673 6:39699246-39699268 GTGAGGAATGCCATGGTGGTTGG + Intronic
1009525132 6:64733909-64733931 ATGACCAGTCCCATGGCGGTGGG + Intronic
1011946376 6:92909196-92909218 GTGAAGAAACTCATGATGGTAGG + Intergenic
1013899373 6:115134755-115134777 ATGATTAATGCCATGGTGGTGGG - Intergenic
1013910096 6:115265288-115265310 GTGAAGAATTCCAGGTTGGTGGG + Intergenic
1016794803 6:148106683-148106705 GTGAAAAATCTCATGGTATTAGG + Intergenic
1021864748 7:24944330-24944352 GTTAAAAATGCCATGGTGGCCGG + Intronic
1024986359 7:55196804-55196826 GTCAACGATCACATGGTTGTAGG + Intronic
1025232468 7:57211759-57211781 GTGAACAAGAACATGGGGGTGGG + Intergenic
1030857917 7:114584684-114584706 GTGGGCAAAGCCATGGTGGTGGG - Intronic
1031335527 7:120526015-120526037 GTGGAAAATCCCATGCTTGTAGG - Intronic
1033734112 7:144205289-144205311 GTGAACACTCCCTTGGGGTTGGG - Intergenic
1033748939 7:144345684-144345706 GTGAACACTCCCTTGGGGTTGGG + Intergenic
1036438729 8:8760808-8760830 ATGGAAAATCCCAAGGTGGTGGG - Intergenic
1036494387 8:9256750-9256772 GTGAAAATTACCATTGTGGTTGG - Intergenic
1040983922 8:53272512-53272534 GTGAAGTATTCCTTGGTGGTCGG - Intergenic
1040987185 8:53308293-53308315 TTGAAGAATCCCATGATGTTAGG - Intergenic
1050179130 9:2900797-2900819 GTGAAGGATCCCAAGATGGTTGG - Intergenic
1051736948 9:20210126-20210148 ATGAACAAGCCCACTGTGGTGGG + Intergenic
1052545259 9:29869594-29869616 GCATACAATGCCATGGTGGTTGG + Intergenic
1052939798 9:34123965-34123987 GGAAATAATACCATGGTGGTTGG - Intronic
1052939806 9:34124034-34124056 GGAAATAATACCATGGTGGTTGG - Intronic
1058736724 9:107900519-107900541 GTGCACAGTGCCATGGTAGTGGG + Intergenic
1059857625 9:118417653-118417675 CTGCACCATCCCATGGTGGAAGG - Intergenic
1060678569 9:125540193-125540215 GTGAAAAATCAGAAGGTGGTAGG - Intronic
1188355302 X:29183367-29183389 TTGAACAATCAAATGGTGGGGGG - Intronic
1188391608 X:29627725-29627747 ATGAACATTCCCATGGTTCTGGG - Intronic
1192351618 X:70360927-70360949 GTGCACATTCCCATGGGGGAGGG - Intronic
1199486738 X:148356749-148356771 CTGCACCATTCCATGGTGGTGGG + Intergenic
1200330154 X:155287244-155287266 GTCAAAAATCACATGGTTGTAGG + Intronic