ID: 1128584102

View in Genome Browser
Species Human (GRCh38)
Location 15:68832459-68832481
Sequence TACTCAATCGTGACTAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128584102 Original CRISPR TACTCAATCGTGACTAGAAC TGG (reversed) Intronic
904015352 1:27415762-27415784 TACTCAATTGTTAATAGCACTGG + Intronic
909262157 1:73504262-73504284 TACTCCATCTTGACCAGAAGAGG - Intergenic
909348779 1:74624195-74624217 AACTCAATAGTTACCAGAACAGG + Intronic
919473119 1:198003311-198003333 TACCCATTCCTGACTAGAATTGG - Intergenic
923336305 1:232973359-232973381 TACTCTATCTTGTCTAAAACTGG - Intronic
924000848 1:239550008-239550030 TGCTCAATGGTGACTGGAAGTGG + Intronic
1065343401 10:24725521-24725543 TACTCAATTGTATCTAGCACTGG - Intergenic
1069046885 10:63752421-63752443 TGCCCAATCTTGCCTAGAACTGG - Intergenic
1071852302 10:89586267-89586289 AACTCTATCTGGACTAGAACAGG + Intronic
1079179076 11:18172855-18172877 GACACACTCGTGACTAGGACTGG - Exonic
1079268342 11:18957393-18957415 GACACACTCGTGACTAGGACTGG + Intergenic
1090861413 11:130656093-130656115 TACTCCATCTTGACTGGAAGTGG - Intergenic
1091466535 12:689587-689609 TGCACAATCTTGCCTAGAACTGG - Intergenic
1093778652 12:23107736-23107758 AGCTCATTGGTGACTAGAACAGG + Intergenic
1095896660 12:47286807-47286829 TGCTTAATCTTGCCTAGAACTGG - Intergenic
1107498040 13:40947956-40947978 TATTCCATCTTGACTAGAAGAGG - Intronic
1108305810 13:49131293-49131315 TACTCACCCGTGACTGGAGCTGG + Exonic
1119095817 14:71829740-71829762 TACTCCATCTTACCTAGAACTGG - Intergenic
1120541834 14:85760644-85760666 TTCTCAATGGTGACGAGAAAGGG - Intergenic
1120572386 14:86137116-86137138 TACTAAATGGGAACTAGAACTGG + Intergenic
1128464212 15:67895893-67895915 TGCCCAATCTTGCCTAGAACTGG - Intergenic
1128584102 15:68832459-68832481 TACTCAATCGTGACTAGAACTGG - Intronic
1132499498 16:279052-279074 TGCCCAATCCTGCCTAGAACTGG - Intronic
1139235009 16:65328716-65328738 TACTCCATCTTGGCTGGAACTGG - Intergenic
1145182310 17:20764169-20764191 TACTCCATCTTGACTGGCACTGG + Intergenic
1155138395 18:23019389-23019411 TACTCCATCATGACCAGAAGTGG + Intronic
1167222120 19:48206475-48206497 TGCCCAATCTTGCCTAGAACTGG - Intronic
927828893 2:26330960-26330982 TACTCCATCTTTTCTAGAACTGG + Intronic
936663504 2:114568358-114568380 TAGTCACTCGTGAATGGAACTGG + Intronic
937213546 2:120295001-120295023 TACCCACTCTTGACTAGAACTGG - Intergenic
939025836 2:137013165-137013187 TACTCAATCTTGGCCAGAAGTGG - Intronic
944929295 2:204500318-204500340 TACTCAATTGTGACAAGAATAGG + Intergenic
1173305406 20:41842696-41842718 TACTCAATTGTCACAAGAGCTGG + Intergenic
1177501866 21:21967211-21967233 TACTCTATCTTGACTGGAAGAGG - Intergenic
1183751686 22:39724487-39724509 TGCCCAATCTTGCCTAGAACTGG - Intergenic
1184900496 22:47443843-47443865 TCCTTAAGCGTGACTAGAGCTGG - Intergenic
952166113 3:30751099-30751121 TGCCCAATCTTGCCTAGAACTGG - Intronic
954846269 3:53560356-53560378 TACTCCATCTTGCCTGGAACTGG + Intronic
963288337 3:143460349-143460371 TACTCCATTTTGACCAGAACTGG + Intronic
963618688 3:147576638-147576660 TACTCAATGGAGATTCGAACTGG + Intergenic
966537945 3:181054889-181054911 TACTGAATGGAGACTAGAAAAGG + Intergenic
966995955 3:185280847-185280869 TACTCAATCATCACTAGTATAGG + Intronic
969614578 4:8244838-8244860 TGCCCAATCCTGCCTAGAACTGG - Intergenic
972232996 4:37097166-37097188 TACTGGATTGTGACTAAAACAGG - Intergenic
975717725 4:77221194-77221216 TACTCCATGGTGGCTTGAACTGG + Intronic
979153029 4:117344460-117344482 TACTCCATCTTGACAAGAAATGG - Intergenic
988232522 5:28498797-28498819 TACGCAATGGTGAGTAGTACAGG + Intergenic
990176950 5:53118602-53118624 TACTCCATCATGACCAGAACTGG - Intergenic
990499201 5:56378457-56378479 ATCTCAACCGTGACTAGAAAAGG - Intergenic
992449390 5:76862328-76862350 TGCCCAATCTTGCCTAGAACTGG - Intronic
992476837 5:77110975-77110997 TAATCAATCTTGAATAGAAGAGG + Intergenic
1004498348 6:16185959-16185981 TATTCAGTGGTGACTATAACAGG - Intergenic
1008566084 6:52769948-52769970 AACACAATCATGACTAGAATTGG - Intergenic
1008570277 6:52810285-52810307 AACACAATCATGACTAGAATTGG - Intergenic
1008647947 6:53534420-53534442 TACTCCATCTTGATTAGAAGTGG - Intronic
1015978462 6:138815177-138815199 TATTCATTCCTGACCAGAACAGG - Intronic
1024010778 7:45264790-45264812 TACTCCATCTTGGCTGGAACTGG + Intergenic
1024442141 7:49432439-49432461 TACTCATGCGTGACTAGCGCAGG - Intergenic
1027208239 7:76121058-76121080 TATTCCATCATGACTAGAAGCGG - Intergenic
1027877892 7:83794877-83794899 CACTCAATACTGACTAGCACAGG + Intergenic
1043026435 8:75076071-75076093 TGCTAAATCGTGGCTTGAACTGG - Intergenic
1043562934 8:81515998-81516020 TACTCCATCTTGGCTAGAAAGGG + Intergenic
1045058565 8:98391768-98391790 TACTCCATCTTAACTAGAACCGG + Intergenic
1046514000 8:115234861-115234883 TACTCAATAGTCACTAGATATGG + Intergenic
1047118648 8:121874576-121874598 TTCTCTTTCGTGACTACAACAGG - Intergenic
1057297304 9:93856531-93856553 TACTCCATCGTGACCATAGCTGG + Intergenic
1061796668 9:133089392-133089414 TCCCCAATCCTGCCTAGAACTGG - Intergenic
1189981585 X:46516151-46516173 TACTCTATTGTGGCTAGAAATGG - Intronic
1192286054 X:69737077-69737099 TACTCCATCTTGACCAAAACTGG + Intronic
1192733689 X:73827389-73827411 TACTCAAAGGTGAGTAGAAAGGG + Intergenic