ID: 1128590632

View in Genome Browser
Species Human (GRCh38)
Location 15:68893645-68893667
Sequence CACCCTTTGTAGTTGTCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128590631_1128590632 15 Left 1128590631 15:68893607-68893629 CCTTTCTCTCTTCTGGCATTTTT 0: 2
1: 0
2: 9
3: 95
4: 1226
Right 1128590632 15:68893645-68893667 CACCCTTTGTAGTTGTCCCACGG 0: 1
1: 0
2: 3
3: 16
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128590632 Original CRISPR CACCCTTTGTAGTTGTCCCA CGG Intronic
904052617 1:27648864-27648886 CACCCTCTTTAGTTCTGCCAGGG - Intergenic
905065885 1:35182191-35182213 CACCCTCTGTGGGTGTCCCATGG + Intronic
907864997 1:58390893-58390915 CACCAGTGGTAGTTCTCCCAGGG + Intronic
910298579 1:85679438-85679460 CTCTCTTTGTAGTTGTCAAAGGG - Intronic
911686820 1:100786976-100786998 CAACCTTTGTGGTAGTACCATGG + Intergenic
911812707 1:102303787-102303809 TACCTTTTGTAGTTATCCTAAGG - Intergenic
912855303 1:113163560-113163582 CCCCGTTTGTATTTGTCTCATGG + Intergenic
919163746 1:193865724-193865746 CACACTTTGTTGTTGTCCATAGG - Intergenic
923922646 1:238585813-238585835 CATCTTTTGGAGTTGTCCCCAGG + Intergenic
924040670 1:239981088-239981110 CTGCCTTTTAAGTTGTCCCAAGG + Intergenic
1062968939 10:1631125-1631147 CACCCTTTTTTCTTGTTCCAGGG - Intronic
1066647474 10:37624533-37624555 CACATGTTGAAGTTGTCCCAAGG + Intergenic
1069606714 10:69743487-69743509 CTCCCTTTCTTGATGTCCCAAGG - Intergenic
1071336961 10:84608225-84608247 CACCCTTTCTTCATGTCCCAAGG - Intergenic
1071915552 10:90291055-90291077 CACCCTTTTGAGTTGTCCAGTGG + Intergenic
1076395954 10:130137232-130137254 CTCCTTTTGTAGTCTTCCCAGGG - Intronic
1088437610 11:109832533-109832555 CAGCCTCTGAAGTTGTACCAAGG + Intergenic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1089857650 11:121560723-121560745 GACACTTTATAGTTTTCCCAGGG - Intronic
1093712344 12:22341353-22341375 CACCCTTTGAAATTGTCCTGTGG - Intronic
1096152901 12:49325726-49325748 CAGCCTCTGTTGGTGTCCCAGGG + Exonic
1098444914 12:70556518-70556540 CACCTTTTGTGGTTGTTCCATGG - Intronic
1105024298 12:132838280-132838302 CAGCCTTTGTAGCTGGCCTAGGG + Intronic
1107592812 13:41926153-41926175 CACCCTTCTTGGTTTTCCCAGGG - Intronic
1109213883 13:59565677-59565699 GCCCCTGTGTAGTAGTCCCATGG + Intergenic
1109362241 13:61309514-61309536 CACTGTTTGTAGTTGTTCCCTGG + Intergenic
1116528103 14:45932844-45932866 CACCTTTTGAAGTTTTCTCACGG - Intergenic
1117084684 14:52187537-52187559 CATCCTTTACAGATGTCCCATGG - Intergenic
1117885890 14:60362431-60362453 CACCCTATGAAGGTGTCCTATGG - Intergenic
1123824477 15:24067624-24067646 CACCCTTTGTCTCTGTCCTATGG + Intergenic
1124168030 15:27346583-27346605 CACCTTTTGTAATTCTCCCATGG + Intronic
1128590632 15:68893645-68893667 CACCCTTTGTAGTTGTCCCACGG + Intronic
1132309265 15:100845015-100845037 CACCCTTAGCTGTTATCCCAGGG + Intergenic
1135942311 16:26832839-26832861 TATCTTTTGTAGTTGTCCCACGG - Intergenic
1141943916 16:87297094-87297116 GAGCTTTTGTAGCTGTCCCAGGG - Intronic
1142040631 16:87891527-87891549 CATCCATGGGAGTTGTCCCAGGG - Intronic
1146061306 17:29608874-29608896 CACACTTTGTAGGTGTCACTAGG - Exonic
1147390396 17:40105891-40105913 CACCCCTTGTCCCTGTCCCAGGG + Intergenic
1149970538 17:61213874-61213896 GCCCTTTTGTATTTGTCCCAGGG + Intronic
1153751648 18:8238237-8238259 CACCTTTTGTAGTTGCCCCATGG + Intronic
1155202054 18:23526040-23526062 CCCCCTTTTCAGTTGGCCCAAGG - Intronic
1156117971 18:33809948-33809970 CACTTTTTGTAATTGTCCCATGG - Intergenic
1157044412 18:44082022-44082044 CACCATTTTCAGTTGTCCCACGG - Intergenic
1168461698 19:56564998-56565020 CACCTTCTGTAATTGTCCCATGG + Intergenic
1168691385 19:58379633-58379655 CAGCCTTTCTAGTTGTCCTTAGG + Intronic
926204149 2:10823172-10823194 CACCCTTGGGATTTGTCCCTTGG - Intronic
926261762 2:11270492-11270514 CACCTTTTCTAGTGGTTCCATGG + Intronic
929824692 2:45301003-45301025 CTCCCTATGTAGTGGTCCCTGGG - Intergenic
933003878 2:76964857-76964879 GGCCCTTTGTAATTTTCCCATGG + Intronic
933629838 2:84643512-84643534 CTCCTTTTGTAGTTGTACCATGG + Intronic
933975530 2:87506389-87506411 CACAATGTGTAGTTGTCCCTTGG + Intergenic
936318295 2:111444424-111444446 CACAATGTGTAGTTGTCCCTTGG - Intergenic
941266097 2:163365262-163365284 TATCTGTTGTAGTTGTCCCACGG + Intergenic
944882056 2:204023312-204023334 CAGTCTTTGTAGGTGTCACAGGG - Intergenic
948363262 2:237437533-237437555 CACCCTTAGAAGGGGTCCCATGG + Intergenic
948899602 2:240949677-240949699 CTCCCTTTGGAGCTGTGCCAGGG - Intronic
1169156844 20:3338615-3338637 TACCTTTTGAAATTGTCCCAGGG + Intronic
1175713207 20:61237642-61237664 CCCCCTTTGGAGTTGTCCTTTGG + Intergenic
1180628270 22:17209092-17209114 TTCCCTTTTTAGTTTTCCCAGGG - Intronic
1182893769 22:33841759-33841781 CACCCTGCTTAGTTTTCCCAGGG - Intronic
1183235012 22:36610431-36610453 CACTCTTTACACTTGTCCCAGGG - Intronic
1185006681 22:48281522-48281544 CTCCTTTTGTAATTGTCTCACGG - Intergenic
949648961 3:6132645-6132667 CTCCCTTTCCAGTTGTCACAGGG - Intergenic
954414023 3:50384195-50384217 CAGCCTTTGTAGATGTCCGTAGG + Exonic
960621509 3:119641368-119641390 CACTATTTGTAATTGCCCCAAGG + Intronic
960857585 3:122119105-122119127 CACCCTTTCTCATTGTCCAAGGG - Intronic
963235296 3:142949850-142949872 CACCTTTTGTAATTGCCCCACGG + Intronic
966641430 3:182195182-182195204 AACCCTTTGGAGTTGTACAATGG + Intergenic
978033532 4:103967391-103967413 CATCCTTTGTAGTTGTCTCATGG + Intergenic
982067927 4:151671131-151671153 CACTGTTTGTTGTTGTCCCTTGG + Exonic
984619638 4:181937660-181937682 CAGCTTTTGTAGTAGTGCCAGGG - Intergenic
986171279 5:5316806-5316828 CACCCTTTCTGGTGGTCCGACGG - Intronic
988375579 5:30431095-30431117 CACCTTTTGAGATTGTCCCATGG + Intergenic
989506694 5:42234146-42234168 CACCTTTTGTAGGTGTCTCATGG + Intergenic
992596767 5:78355187-78355209 CACCCTTTGCATTTTTCCCTTGG + Intergenic
993935852 5:94001458-94001480 CATCATTTGTAGTTGCCCCATGG + Intronic
996549268 5:124712671-124712693 CACCCTGTGGAGTTGGCCCAGGG + Intronic
996778801 5:127160821-127160843 CACCCTTGCTAGTGATCCCAGGG + Intergenic
999775997 5:154813659-154813681 CACCCTTTGATGTGGACCCATGG - Intronic
1007964629 6:45992541-45992563 CACGCTATGTAGTTTACCCAGGG - Intronic
1012501413 6:99892048-99892070 TACCTTTTGTAATTGTCCCAGGG + Intergenic
1012862060 6:104571966-104571988 CTGCCTATGAAGTTGTCCCAGGG - Intergenic
1018327779 6:162692451-162692473 CACCCGTTCTAGTTCACCCAGGG + Intronic
1021834670 7:24658065-24658087 GGCCCATTGAAGTTGTCCCATGG + Intronic
1026103610 7:67403015-67403037 CACCCTTTGCAGTTGAACTAAGG + Intergenic
1030793849 7:113762549-113762571 CACCCTATGGACTTGTCCAATGG + Intergenic
1031500238 7:122505687-122505709 CACCTTTTTCAGTTGTCTCATGG - Intronic
1035746223 8:1963576-1963598 CACCCTGTGTAGATGGCACATGG + Intergenic
1036704840 8:11039320-11039342 CACTCTTTGTAGCTTTCCCAGGG - Intronic
1037456912 8:19072932-19072954 CATCCTTTATAGTTGGGCCAAGG - Intronic
1043479953 8:80642895-80642917 CACCCTTTCTTTTTTTCCCATGG - Intronic
1044597510 8:93972780-93972802 CAGCCTTTGATGTTGTCCCCAGG + Intergenic
1045182507 8:99800248-99800270 AACCCTTTGTGGTGGTACCAAGG + Intronic
1046502175 8:115092864-115092886 CACCTTTTGTAGTTGGCCCACGG + Intergenic
1050310121 9:4344207-4344229 CACCATTTTTATTTGCCCCAGGG + Intronic
1050628790 9:7537000-7537022 CACCTTTTGTAAATGTCCTAAGG + Intergenic
1051798062 9:20898371-20898393 TAACTTTTGTAGTTGTCCCACGG + Intronic
1058779835 9:108321889-108321911 CACCCTGTGAAGTTGTGACAAGG - Intergenic
1062243979 9:135553956-135553978 GACCCTTTGAGGTTGTCTCATGG + Intergenic
1187204086 X:17165570-17165592 CACCCTATTTAGTTGTCTGAGGG + Intergenic
1198059319 X:133028735-133028757 CACTTATTGTAGTTGCCCCATGG - Intronic
1198081438 X:133243773-133243795 CACCCTTCTTAGCTGTCCCAAGG - Intergenic