ID: 1128592423

View in Genome Browser
Species Human (GRCh38)
Location 15:68912456-68912478
Sequence TTTTTATTGTCACTACTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128592423_1128592425 -3 Left 1128592423 15:68912456-68912478 CCAGGGAGTAGTGACAATAAAAA 0: 1
1: 0
2: 0
3: 19
4: 227
Right 1128592425 15:68912476-68912498 AAAGTAGGTCAACTTTCCATTGG 0: 1
1: 0
2: 1
3: 10
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128592423 Original CRISPR TTTTTATTGTCACTACTCCC TGG (reversed) Intronic
900405495 1:2491127-2491149 TTGTCATTGCCACTACTCGCAGG + Intronic
900731853 1:4267348-4267370 TTTTTTTTTTCACTAATTCCGGG + Intergenic
902056034 1:13601145-13601167 GTTTTATTCTAGCTACTCCCTGG + Intronic
904813232 1:33177649-33177671 TTTTGATTGTCACAACTTGCGGG + Intronic
904904020 1:33880878-33880900 TTCTTATTGTCACTTATCACTGG - Intronic
905680080 1:39864194-39864216 TTTTGATTGTCACAACTGCAGGG + Intronic
906911485 1:49956403-49956425 TTTTTATTTTCTGTACTTCCTGG - Intronic
907077948 1:51595108-51595130 TCATTATTCTCACTACCCCCAGG - Intronic
908071445 1:60464864-60464886 TTTTTTTCCTCTCTACTCCCTGG + Intergenic
908343827 1:63210990-63211012 TTTCTATTGTCATTCCACCCAGG - Intergenic
908566634 1:65363622-65363644 TTTTTATTGTCACAACTCAGAGG + Intronic
909131814 1:71746568-71746590 TTTTTCTTGTTAATTCTCCCTGG + Intronic
909376336 1:74946367-74946389 TTTTTATAGTAACTACACCGAGG - Intergenic
910340046 1:86175951-86175973 TTCTTATTTTCAGTACTGCCAGG - Intergenic
912094937 1:106127780-106127802 TTTTTATTGTCACCATTAGCTGG - Intergenic
912782316 1:112562637-112562659 TGTTCATTGTCACTGTTCCCTGG - Intronic
915793089 1:158696271-158696293 TTTTTATTGTCCTTAATCACAGG - Intergenic
917067339 1:171111214-171111236 CTTTGATTATCATTACTCCCGGG - Intronic
917723608 1:177809643-177809665 TTTATCTTCTCACTCCTCCCAGG - Intergenic
918333127 1:183479378-183479400 TTTTTATTGTCACGATTGCAAGG - Intronic
919117482 1:193298526-193298548 TTTTTAGTGGCCCTAGTCCCTGG + Intergenic
919600104 1:199611756-199611778 TTTTGATTGTCACTCCTCAGAGG + Intergenic
920999278 1:211026362-211026384 TTTTTTTTGTCTATACTCCTTGG - Intronic
921537913 1:216374962-216374984 ATTTCAGTGTTACTACTCCCAGG + Intronic
921586629 1:216954205-216954227 TTTTTAATTGCACTACTCCATGG + Intronic
923420347 1:233808860-233808882 TTTTTAATGTTACTACCTCCAGG + Intergenic
1065106156 10:22388242-22388264 TTTTGATTGTCACCACTTGCGGG - Intronic
1065256084 10:23869795-23869817 TTTTCATGGACACTATTCCCAGG + Intronic
1065377056 10:25053998-25054020 TTTATATTGTCACTACTGGTTGG + Intronic
1065572302 10:27083665-27083687 GTTTTTTTGTCACTAATCCTTGG - Intronic
1068540594 10:58290442-58290464 TTTTTTTTTTCACTGCTCCATGG + Intergenic
1072679354 10:97495215-97495237 CTTTTTTTCTCACTGCTCCCTGG - Intronic
1072916758 10:99541430-99541452 CTCTTCTTGTCACTACTACCTGG + Intergenic
1073241241 10:102059723-102059745 TTTTTCTTTTTACTGCTCCCAGG - Intergenic
1074327733 10:112469256-112469278 TTTTCATTATCACTTCTCCAAGG + Intronic
1075482151 10:122791002-122791024 TTTTTCTTGTCTTTATTCCCTGG + Intergenic
1075597392 10:123742050-123742072 TTTTTCCTGTCTCTACCCCCAGG + Intronic
1076923970 10:133471996-133472018 TTTTTATTGTCACAACTGGAAGG - Intergenic
1077725714 11:4672977-4672999 TTTTTATGGTCCTTAGTCCCTGG + Intergenic
1078797643 11:14608812-14608834 TTTTTACTGTAATTTCTCCCTGG - Intronic
1079024206 11:16933086-16933108 TTTTTATCGTCCTTAATCCCCGG - Intronic
1080656618 11:34263512-34263534 CTTTTATTGTCACTTGTCACAGG + Intronic
1081122290 11:39282481-39282503 TTTTGATTGTCACTCTTTCCTGG - Intergenic
1081452436 11:43184429-43184451 TTTTCACTTTCACAACTCCCAGG + Intergenic
1082181012 11:49119667-49119689 TTATTATTGTCACAATTACCAGG + Intergenic
1083979570 11:66155999-66156021 ATTTTATTGTCACTATCCACTGG - Intronic
1084277532 11:68061905-68061927 TTTTTTTTCTTCCTACTCCCAGG - Intronic
1085769714 11:79313912-79313934 CATTTATTTTCTCTACTCCCCGG + Intronic
1086288744 11:85280023-85280045 CTTGTTTTGTCACTTCTCCCTGG - Intronic
1086299036 11:85404461-85404483 TTTTTATAATCCCTACTCCCTGG - Intronic
1088326811 11:108609176-108609198 TTTTGATTGTCACAGCTCCAGGG + Intergenic
1094669383 12:32554568-32554590 TGTTTATTGTCAGTTTTCCCTGG - Intronic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1097298073 12:57988865-57988887 TGTTTATTGTCTTTATTCCCAGG - Intergenic
1097641397 12:62187170-62187192 TTTTTATTGACACTACAACTGGG - Intronic
1097927841 12:65150152-65150174 CTTTTACTGTCACTGCTGCCTGG + Intergenic
1099642270 12:85306221-85306243 TCTTTATTTTCACTAATACCTGG + Intergenic
1102383418 12:112486454-112486476 TTTTTCTTGGCTCTACTCCAGGG + Exonic
1103089964 12:118090832-118090854 GTTTAAATGTCACTACTTCCAGG + Intronic
1105339535 13:19507398-19507420 ATTTTACTGTAACTACTCCTGGG - Intronic
1106066436 13:26356234-26356256 TTTTTATTGTCACTATATGCTGG + Intronic
1106690427 13:32109479-32109501 TTTTAAATGTCACTGCTCCTTGG - Intronic
1106953504 13:34910276-34910298 TTTCTATTGTCAGTATTTCCTGG - Intergenic
1107377119 13:39815918-39815940 TTTTGATTTTCACAACTCCGGGG - Intergenic
1108846280 13:54681054-54681076 TTGTTATAGTCCTTACTCCCTGG - Intergenic
1110121832 13:71891738-71891760 TTTGTGTTGTGACTACCCCCAGG + Intergenic
1111093780 13:83482500-83482522 TTTTTATTGACACTCTACCCAGG - Intergenic
1112249024 13:97761641-97761663 ATTTTAATGTCACTACTGTCTGG + Intergenic
1114490324 14:23096579-23096601 TTTTTTTTGTCACTCCACTCTGG + Intronic
1114839130 14:26242437-26242459 TTTTTATTATTACTAGTTCCTGG + Intergenic
1115312171 14:31990147-31990169 TTTTTATTTTCACTTCATCCTGG + Intergenic
1115438085 14:33399735-33399757 TTTTTAATCTCACTACTCTTAGG + Intronic
1115826934 14:37289134-37289156 TTTTTATTGTGAGGAATCCCTGG + Intronic
1115890354 14:38019750-38019772 ACTTTCTTGTCACTAATCCCTGG + Intronic
1116971346 14:51069358-51069380 TTTTTTTTGTCACAACTCAGAGG + Intronic
1117692824 14:58325906-58325928 TTTTTATTTTCAATATCCCCTGG - Intronic
1118910487 14:70058219-70058241 TTTTCATTATCACTACTGCATGG - Intronic
1119545430 14:75468292-75468314 TTTTGATTGTCACAACTCAGAGG - Intronic
1121569857 14:94939538-94939560 TTTTAATTCTCACTCCTTCCAGG + Intergenic
1124787260 15:32693192-32693214 CTTTAATTGTCTCTACTTCCTGG + Intronic
1126262985 15:46716093-46716115 TTTTTATTGTCACTACTGTGGGG - Intergenic
1127537267 15:59901544-59901566 TTTTTCTTCCCACTACTCACTGG + Intergenic
1128592423 15:68912456-68912478 TTTTTATTGTCACTACTCCCTGG - Intronic
1130132029 15:81151826-81151848 ATTTAATTTTCACTACTCTCTGG + Intergenic
1131672123 15:94631188-94631210 TTTTTAATTTCTCTCCTCCCAGG + Intergenic
1131937745 15:97525464-97525486 TTTTTATGTTCACTAGTCCATGG - Intergenic
1133760169 16:8792223-8792245 TTTTTATTTTCACGGTTCCCTGG - Intronic
1134144504 16:11749282-11749304 TTTTTATTATCTATTCTCCCTGG + Intergenic
1135509992 16:23074201-23074223 TTTTGATTGTCACAACTCAAGGG + Intronic
1135814359 16:25618683-25618705 TTTTCATTGTCTCTCCACCCCGG - Intergenic
1136656267 16:31711167-31711189 GTTTTACTGCCACAACTCCCAGG + Intergenic
1144526594 17:15995648-15995670 TTTATATTTTCTCTACTTCCTGG - Intronic
1145118787 17:20236845-20236867 TTTCTATTTTCACAGCTCCCTGG + Intronic
1145820350 17:27829112-27829134 TTTTTATTAACATTACTCCCTGG + Intronic
1145847054 17:28049407-28049429 TTTTTATTGTCACTTCGCTGTGG + Intronic
1149063593 17:52453887-52453909 TTTTGCTTGTCTCTTCTCCCTGG + Intergenic
1149098983 17:52881675-52881697 TTTTTATTCTCAAGACTTCCAGG + Intronic
1150990771 17:70255989-70256011 TTTTTATTCTCAATACTACATGG - Intergenic
1151781958 17:76252687-76252709 TTTTTTTTTTCACTATACCCGGG + Intergenic
1153615129 18:6927155-6927177 TTTCCATTGTCACTACCACCAGG - Intergenic
1154969628 18:21394274-21394296 TTTGGAGTGTCACAACTCCCTGG + Intronic
1157050110 18:44153572-44153594 TTTTAATTTTCACTAAGCCCTGG + Intergenic
1158190150 18:54818507-54818529 ATTTTGTTGTCCCTACTCCAGGG + Intronic
1160123991 18:76153913-76153935 GTTTTATGGTCCCTCCTCCCGGG + Intergenic
1161833261 19:6625729-6625751 TTTTGATTGTCATTTTTCCCTGG + Intergenic
1161918850 19:7251137-7251159 TTTTGGTTGTCACAACTCCAGGG - Intronic
1164392321 19:27835660-27835682 TTGTTATAGTCAACACTCCCTGG - Intergenic
1164912155 19:32021703-32021725 TTTTTTTTTCCACTAATCCCAGG + Intergenic
1165070841 19:33254113-33254135 TTTGTGTTCTCACTCCTCCCTGG + Intergenic
1165285737 19:34839916-34839938 TTTTTATTGTCCTTAGTCCATGG + Intergenic
1166227816 19:41407828-41407850 CTTTTCTTCCCACTACTCCCGGG - Intronic
924978997 2:203244-203266 TTTTTTTTCTTACTATTCCCTGG + Intergenic
925698256 2:6605948-6605970 TTATTTTTGTTCCTACTCCCTGG - Intergenic
929455239 2:42060581-42060603 TTTTTCTGTTCACTACACCCGGG - Intergenic
930485006 2:52000230-52000252 TTTTTTTTTTCACTACACCAGGG + Intergenic
931244177 2:60478971-60478993 TTTTTTTTTTCCCTCCTCCCTGG + Intronic
932175208 2:69594536-69594558 TTTTCATGGTTACTACTGCCAGG + Intronic
932634748 2:73378458-73378480 TTTTTAATATCACCACTACCTGG - Intergenic
933968888 2:87453896-87453918 TTTTTATTTTCAGTTCTCCTAGG + Intergenic
936324904 2:111496609-111496631 TTTTTATTTTCAGTTCTCCTAGG - Intergenic
936376432 2:111945324-111945346 TTTTTATTGTCAATAATCTGTGG - Intronic
939988969 2:148859465-148859487 TTTTTATTCTCACCAATCCATGG - Intergenic
941109121 2:161398015-161398037 TTTGTATTGGTACTACTGCCAGG + Intronic
941588175 2:167385433-167385455 TTTTTATAACCACCACTCCCTGG + Intergenic
942238706 2:173938938-173938960 TTTTTATTATCACAACTGCCTGG + Intronic
943551171 2:189340724-189340746 TTTTGATTGTCACCTCTCCTGGG + Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
947945654 2:234099769-234099791 TTTTTCTTGTCATTATTCCCTGG - Intergenic
1169603760 20:7291931-7291953 TTTTTAATGTGACTACTACTAGG - Intergenic
1170083631 20:12504688-12504710 TTTTCATTGACAATATTCCCTGG - Intergenic
1170776938 20:19383384-19383406 TTTTTTTTCCCACTACCCCCAGG + Intronic
1171239658 20:23554919-23554941 TTTTTATCCTCACTCTTCCCTGG + Intergenic
1174297273 20:49557610-49557632 TTTTTATTTTCCTTTCTCCCCGG - Intronic
1174498725 20:50968501-50968523 TTTTGATTGTCACAACTGCGGGG + Intergenic
1174518065 20:51108616-51108638 TTGTTATTGTTACTCCTGCCTGG + Intergenic
1174603774 20:51745544-51745566 GTTTGATTGTCACTACTACAGGG + Intronic
1175663569 20:60838676-60838698 TTTTTATTGTCAATACTATAGGG - Intergenic
1176734653 21:10534347-10534369 ATTTTACTGTAACTACTCCTGGG + Intronic
1177604664 21:23361743-23361765 TTTTTATTGTCATTATTTTCTGG + Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1178744792 21:35238415-35238437 TTCTTATTGTCCCTGCTCTCTGG - Intronic
1179005334 21:37508855-37508877 TCTTAAGTATCACTACTCCCAGG + Intronic
1180642405 22:17309919-17309941 TTTTCCTTCTCATTACTCCCAGG + Intergenic
1182030807 22:27157818-27157840 CTTTTAATGTCACAAATCCCTGG - Intergenic
1182919404 22:34065538-34065560 TTTTCATTGTCACAATTCCAGGG + Intergenic
1184947842 22:47816858-47816880 GTTTTACTTTCACTACTCCTCGG - Intergenic
1184977501 22:48073309-48073331 TTTTTATTGTCACTTTTCATTGG - Intergenic
949472335 3:4409383-4409405 TTTTTCTTTTCACCAATCCCAGG - Intronic
950248559 3:11444317-11444339 TTTTCATTATCACTCCTCCTAGG + Intronic
952078154 3:29723907-29723929 TTTATACTGTAAATACTCCCAGG + Intronic
952235885 3:31479823-31479845 TTTTTATTAGAACTACTCCTAGG - Intergenic
952260559 3:31735863-31735885 TGTTGATTGTCTCTCCTCCCTGG + Intronic
954989521 3:54828315-54828337 TTTTCATTGTCATTAGTCCTGGG + Intronic
955217694 3:56997809-56997831 TTTCTATTTTCACTCCTCCAGGG + Intronic
956156414 3:66303048-66303070 TTTAAATTGTCACTACTCACGGG - Intronic
957763353 3:84588992-84589014 TTTTTATTGTTACTATTCACAGG - Intergenic
958918997 3:100081884-100081906 TTTTAATTGTCACAACTCGGAGG - Intronic
959218644 3:103485214-103485236 TTTTTATTGCTAGTACTTCCAGG - Intergenic
960294233 3:115923703-115923725 TTTTTATTGTCTCTCCTACCTGG + Intronic
962918196 3:139927670-139927692 TTTTAAATGTCACTTCTCCAGGG - Intergenic
962960379 3:140305847-140305869 TTTTTAGTGTCAGTCCTGCCAGG - Intronic
966084292 3:176049309-176049331 TTTCTATTATCCCTACTTCCTGG + Intergenic
967965359 3:194956366-194956388 ATGTTATTGTCCCTACTACCGGG + Intergenic
970253592 4:14143044-14143066 TTTTAAATGTCACTTGTCCCAGG - Intergenic
970886880 4:20996673-20996695 GTGTTTTTGTCACCACTCCCTGG + Intronic
972547841 4:40097961-40097983 TTTTTATTGTCACAACTGGGTGG - Intronic
972938605 4:44169211-44169233 TTTTTATTATCACTATGCACTGG + Intergenic
973305259 4:48640872-48640894 TTTTTATTTTCACTCTTCCCAGG - Intronic
974932569 4:68375678-68375700 TTATTATTGTCACTATTCATGGG + Intergenic
975618117 4:76267688-76267710 TTTTTATGGCCAATACTCCATGG - Intronic
976138012 4:81959865-81959887 TTCTTGCTGTCACTAGTCCCTGG + Intronic
976325977 4:83772016-83772038 TTCTTAATCTCACTACCCCCAGG - Intergenic
976661060 4:87540996-87541018 TTTTCATTGTCACTCCCCCAAGG + Intergenic
976960355 4:90964329-90964351 TTTTTATTTTCTCTATTACCAGG - Intronic
981422754 4:144570409-144570431 TTTTTGTTGTCACTAGACTCTGG + Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
984347230 4:178544301-178544323 TTCTTTTTCTCATTACTCCCTGG + Intergenic
986078996 5:4369425-4369447 TTTTTCTTGTCACAACTGACAGG - Intergenic
986983790 5:13477920-13477942 TTTTCATTGTAACAACTCCCTGG - Intergenic
987194821 5:15515955-15515977 TTATTATTATCACTACTACGGGG + Intronic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
990505035 5:56435484-56435506 TTTTTATTTTCTCTATTCCTCGG + Intergenic
993596443 5:89862568-89862590 GTTTCATTCTCACTACTCCATGG - Intergenic
995224422 5:109688237-109688259 TATTTCTTGGGACTACTCCCGGG + Intergenic
995366189 5:111364056-111364078 ATTTTATTTCCTCTACTCCCAGG + Intronic
995411671 5:111864606-111864628 TTTTTATTATCACTACCCTAAGG - Intronic
996076539 5:119201532-119201554 TTTTTGTTGTTACTTCTGCCAGG + Intronic
996811461 5:127520188-127520210 TTTTTATTGTCACTACTAGAGGG - Intronic
997381664 5:133442646-133442668 TTTTAATTCTCACTTCTACCAGG - Intronic
998657799 5:144201629-144201651 TTTTTATTGCCACCATACCCTGG + Intronic
998672804 5:144372753-144372775 TTGTTTTTCTTACTACTCCCTGG - Intronic
999229130 5:150051360-150051382 TCATTATTGTCATTACTCCCTGG + Intronic
1001444373 5:171771931-171771953 TTTTTATGGTTACTACACCCTGG - Intergenic
1003665980 6:8111729-8111751 TTTCTATTCTCGCTAGTCCCTGG + Intergenic
1004147406 6:13080760-13080782 TATTTATTGTCATTTCTACCAGG - Intronic
1004262483 6:14120098-14120120 TTTTCATTGGCACTATTCCATGG - Intronic
1004525040 6:16399683-16399705 TTTTGATTGTCACAACTGCCGGG + Intronic
1008370988 6:50730331-50730353 TTATTATTGTGACTACTATCAGG - Intronic
1009389432 6:63127772-63127794 ATTTTATTGACACTATTCCACGG - Intergenic
1011095859 6:83661240-83661262 TTTTTCTTCTCTCTAATCCCAGG - Intronic
1013911967 6:115286515-115286537 TTCTTATTGTCACAAATGCCAGG + Intergenic
1014095029 6:117450522-117450544 TTTTTAAATTAACTACTCCCTGG + Intronic
1016529865 6:145045739-145045761 TGTTTTTTGTCACTAATCACAGG + Intergenic
1019139069 6:169932095-169932117 TTTTTATTGTCACAACTGGGAGG - Intergenic
1020435750 7:8160817-8160839 TTTTTATAGTCAGAGCTCCCAGG - Intronic
1020940380 7:14526339-14526361 TTTTTATTGTCACAACTTGAGGG - Intronic
1021646258 7:22792644-22792666 TTTTTATTCTCCTTTCTCCCAGG + Intergenic
1022688293 7:32617795-32617817 TTTTTATTTTTCCTACTTCCTGG - Intergenic
1024130557 7:46348494-46348516 CTCTTATTATCACTACTCCCAGG + Intergenic
1025006184 7:55356806-55356828 TTTTTATTGTCACAACTGTTGGG + Intergenic
1030865942 7:114701924-114701946 TATTTAATGACACTACTCCAAGG + Intergenic
1031192043 7:118565337-118565359 TTTTTATTGTCATTACTTGGGGG - Intergenic
1033928608 7:146495338-146495360 TTTTTATTGTCTCTATTCTGTGG - Intronic
1034085566 7:148319403-148319425 TTTGTTTTTTCACTACTCCAAGG + Intronic
1035946932 8:3974401-3974423 TTTTTATTTTCACTTCGACCAGG + Intronic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1037268608 8:17099035-17099057 TTTTTATTTTCACTATGCACTGG - Intronic
1037404173 8:18523705-18523727 TTTTTATTGCCAGTTCTTCCTGG + Intergenic
1038555407 8:28509596-28509618 TTTTTCTTCTCCCTAGTCCCTGG + Intronic
1038850700 8:31272665-31272687 TTTTTATTGTAACTGCTAACTGG - Intergenic
1041982605 8:63880466-63880488 TTTTTAGGTTCACTACTCCCAGG - Intergenic
1043226677 8:77741366-77741388 TTTTCATTGTCATTCATCCCAGG - Intergenic
1045870576 8:106922499-106922521 TTATTACTGTGAATACTCCCAGG + Intergenic
1046169503 8:110486238-110486260 TTCTTGTTGTAACCACTCCCTGG - Intergenic
1047776339 8:128073767-128073789 TTGTTATTCTCACAGCTCCCAGG - Intergenic
1048065928 8:130968482-130968504 TTTTTATCATCACTATTCCTTGG + Intronic
1049096744 8:140552876-140552898 TTTTTATTGTCACAACTTGGGGG - Intronic
1049130253 8:140833295-140833317 TTTTTATTTTCTCAACTGCCAGG - Intronic
1050810114 9:9734464-9734486 TTTTGTTTGTCACTATTCCTTGG - Intronic
1052021848 9:23533986-23534008 TTTGTGTTGTTACTCCTCCCAGG + Intergenic
1052711054 9:32056211-32056233 TTTTTATTTTCACTTCTCTTTGG - Intergenic
1053385605 9:37684924-37684946 TTTTTATTTTCAGTACACACAGG + Intronic
1054768563 9:69063629-69063651 TTATTATTGTTACTACCCTCTGG + Intronic
1055693079 9:78855021-78855043 TTTTCATTTTCACTACTCTCCGG - Intergenic
1059808694 9:117832137-117832159 TTTTTATTGTCAGAACTAACAGG + Intergenic
1186175793 X:6924642-6924664 TTTTGACTGTGACTCCTCCCAGG + Intergenic
1186852111 X:13590856-13590878 TTTTAATTGACACAAGTCCCAGG - Intronic
1187858487 X:23659785-23659807 TTTTTATTGTTCCTTCTGCCAGG - Intergenic
1188807674 X:34612249-34612271 TTTCAGTTGTCAGTACTCCCTGG + Intergenic
1189131867 X:38507471-38507493 TTTTAATTATCAATACTCCTTGG - Intronic
1189705958 X:43759077-43759099 TCTTCACTGTCTCTACTCCCTGG - Intergenic
1196536276 X:116848579-116848601 TTTGTGTTGTTACTACTGCCTGG + Intergenic
1198954765 X:142116450-142116472 TTTTTACTGTCACTATCCACTGG + Intergenic
1199612826 X:149632097-149632119 CACTCATTGTCACTACTCCCAGG - Intergenic
1201456102 Y:14168288-14168310 TGTTTATTGTCTGTACTCCCAGG + Intergenic
1202592688 Y:26503859-26503881 ATTTTACTGTAACTACTCCTGGG + Intergenic