ID: 1128593097

View in Genome Browser
Species Human (GRCh38)
Location 15:68920079-68920101
Sequence TTCCCTCTCATTGCATCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 283}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128593097_1128593098 0 Left 1128593097 15:68920079-68920101 CCAGGGGATGCAATGAGAGGGAA 0: 1
1: 0
2: 1
3: 27
4: 283
Right 1128593098 15:68920102-68920124 ATGAGAAATAACTGCTTACCAGG 0: 1
1: 0
2: 1
3: 33
4: 220
1128593097_1128593099 5 Left 1128593097 15:68920079-68920101 CCAGGGGATGCAATGAGAGGGAA 0: 1
1: 0
2: 1
3: 27
4: 283
Right 1128593099 15:68920107-68920129 AAATAACTGCTTACCAGGTATGG 0: 1
1: 0
2: 3
3: 10
4: 178
1128593097_1128593103 20 Left 1128593097 15:68920079-68920101 CCAGGGGATGCAATGAGAGGGAA 0: 1
1: 0
2: 1
3: 27
4: 283
Right 1128593103 15:68920122-68920144 AGGTATGGAGTTTTCTTTTGGGG 0: 1
1: 4
2: 34
3: 169
4: 997
1128593097_1128593101 18 Left 1128593097 15:68920079-68920101 CCAGGGGATGCAATGAGAGGGAA 0: 1
1: 0
2: 1
3: 27
4: 283
Right 1128593101 15:68920120-68920142 CCAGGTATGGAGTTTTCTTTTGG 0: 1
1: 0
2: 0
3: 25
4: 292
1128593097_1128593102 19 Left 1128593097 15:68920079-68920101 CCAGGGGATGCAATGAGAGGGAA 0: 1
1: 0
2: 1
3: 27
4: 283
Right 1128593102 15:68920121-68920143 CAGGTATGGAGTTTTCTTTTGGG 0: 2
1: 0
2: 8
3: 94
4: 615

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128593097 Original CRISPR TTCCCTCTCATTGCATCCCC TGG (reversed) Intronic
900572386 1:3365002-3365024 TTCCCTTCCTTTGCATCCCCTGG - Intronic
900678090 1:3900936-3900958 GCCCCTCCCCTTGCATCCCCTGG + Intergenic
901246959 1:7739343-7739365 TTCCTGCTCATTGCATCCCAGGG + Intronic
901610227 1:10492052-10492074 TTCCCTCTCATTCCAACCCTAGG - Intronic
902185668 1:14723408-14723430 GTCCCACTCATTGCTGCCCCGGG - Intronic
903789162 1:25881021-25881043 TTCCCTCTCACTTCAAGCCCAGG + Intergenic
904421684 1:30398344-30398366 TTCACTCTCCTTCAATCCCCAGG - Intergenic
904690939 1:32292701-32292723 ATCCTTCTCCTTGCAACCCCTGG - Intronic
905410132 1:37762981-37763003 TTCCCACTCCATACATCCCCAGG + Intronic
905934825 1:41815085-41815107 TTACCTCTTATTACATCCCCAGG - Intronic
906096378 1:43226961-43226983 TTCTCTCTCATCTCACCCCCAGG + Intronic
907392582 1:54167980-54168002 CTCCCTCTTGCTGCATCCCCAGG - Intronic
907624772 1:56018762-56018784 TTCTCTCACATTTCAACCCCAGG - Intergenic
907865546 1:58396246-58396268 TTCCCTCTGACTGGAGCCCCTGG - Intronic
907959033 1:59261083-59261105 TTCTCTATCTCTGCATCCCCAGG + Intergenic
908763159 1:67530830-67530852 GTCCCTATCATTGCCTCCCACGG - Intergenic
909535544 1:76732094-76732116 TTCCCTCTCCTCTCAGCCCCTGG + Intergenic
911800960 1:102137207-102137229 TTTCCTCTCACTGCATACACTGG - Intergenic
915524616 1:156468104-156468126 TCCCGTCTCATAGGATCCCCCGG + Exonic
915825637 1:159073162-159073184 TTTCCTTTCATGGCATCCCTGGG - Intronic
915942694 1:160128959-160128981 TTCCCCCTCATTTCCTCCCAGGG + Exonic
916732296 1:167577123-167577145 TTCCCTTTACTTTCATCCCCAGG + Intergenic
918076082 1:181172682-181172704 CTCCCTATGATTTCATCCCCTGG + Intergenic
919301649 1:195776356-195776378 TTGAATATCATTGCATCCCCAGG + Intergenic
920496276 1:206457093-206457115 TTCCTTTTCTTTACATCCCCAGG + Intronic
921384220 1:214552492-214552514 TTCCCTCCCAGTGCCTACCCAGG - Intergenic
922360495 1:224817279-224817301 TTTCCTCTCATTCCAACCTCAGG + Intergenic
922433086 1:225575317-225575339 TTCCCTCTCAATGCTTCCAGAGG + Intronic
1063063540 10:2584954-2584976 TTCCTTCTCATTGCTTCTTCTGG - Intergenic
1063311084 10:4952531-4952553 TTCCCCCTTATTTCATCCTCTGG - Intronic
1063501227 10:6556521-6556543 TTCCCTCTCCTTTCAGTCCCAGG - Intronic
1063580449 10:7301626-7301648 CTCCCTCTCATTGCAGTCTCTGG - Intronic
1063864950 10:10353760-10353782 TCCCCTCTAAATGCATGCCCAGG + Intergenic
1064277284 10:13917760-13917782 GTCCCTCTCTTTGCAACACCCGG + Intronic
1067411971 10:46072814-46072836 TTCCTTCTCATTCCAGCCCCTGG - Intergenic
1068012891 10:51476756-51476778 TTCGCTCTCATTCCTCCCCCTGG + Intronic
1070498137 10:77043826-77043848 TTCCCTCTCCCTGCAACCCCTGG - Intronic
1070502279 10:77083140-77083162 TTCCGTCCCACTGCATTCCCAGG - Intronic
1070868191 10:79723138-79723160 TTTCCTCTCCTTCCAGCCCCTGG - Intergenic
1071635101 10:87245339-87245361 TTTCCTCTCCTTCCAGCCCCTGG - Intergenic
1071973750 10:90934217-90934239 TTCCCTGTCATTGGCTTCCCTGG - Intergenic
1073868895 10:107838709-107838731 TACCCTCTCATATCATGCCCAGG + Intergenic
1074062793 10:109982976-109982998 TTCCCTCTCCCTCCAGCCCCTGG - Intergenic
1074291960 10:112144442-112144464 TTCCCTCTCACTGCAGACACAGG - Intergenic
1074615716 10:115066119-115066141 TTCCCTCTCCTCTCAGCCCCTGG - Intergenic
1074806543 10:117058966-117058988 TTCCTCCTCCTTTCATCCCCTGG - Intronic
1075319056 10:121475069-121475091 TTCTCTCACATTTCATCCCCAGG - Intergenic
1076686023 10:132198829-132198851 ATCCCTCTCATCTCGTCCCCAGG + Exonic
1077744147 11:4881939-4881961 TTCCTCCTCACTGCATTCCCTGG + Exonic
1078360498 11:10664175-10664197 GTCCTTCTCACGGCATCCCCTGG + Intronic
1078792548 11:14559014-14559036 TTCCCTCTCAAAACTTCCCCAGG - Intronic
1080434691 11:32228855-32228877 TCCCCTCTCCTCCCATCCCCTGG - Intergenic
1080667732 11:34350492-34350514 TGCCCTCTTCTTCCATCCCCAGG + Intronic
1081891707 11:46548248-46548270 TGCCCTCCCATTTCATCCACCGG + Exonic
1081927384 11:46842257-46842279 TTCCTTCACATTGTACCCCCTGG - Intronic
1083896932 11:65624715-65624737 TCCCCTCTCCTTCCCTCCCCAGG + Intronic
1084310973 11:68316098-68316120 TTCCCTCTCCCCGGATCCCCTGG + Intronic
1084490440 11:69475519-69475541 TCCCCTCCCATTGCTTCCCGGGG + Intergenic
1086046901 11:82543310-82543332 TTTCCTTTCATTGCATTGCCTGG + Intergenic
1086270553 11:85060098-85060120 TTCCCTCTCTCTCCAGCCCCTGG + Intronic
1087219560 11:95531625-95531647 TTTCCTCTCTTTGGATCTCCTGG - Intergenic
1088525163 11:110745216-110745238 TTCCCTCTCTTCTCAGCCCCTGG + Intergenic
1089189947 11:116646411-116646433 TTCCCTCTCACTGCCTTTCCTGG - Intergenic
1089998951 11:122936888-122936910 TTTCCTCTTTTTGCATCCTCTGG + Intronic
1090151602 11:124390225-124390247 TCCCCCCTCATTGCATTGCCTGG - Intergenic
1090371079 11:126253186-126253208 TTCCTTCTCATTTCATCCTTGGG + Intronic
1090460545 11:126887870-126887892 TGCTGTCTCATTCCATCCCCAGG - Intronic
1091018379 11:132075172-132075194 TCCCCTCTCATTCCAGCCCCTGG - Intronic
1091891898 12:4062760-4062782 TTCCCTCCATTTTCATCCCCAGG + Intergenic
1092813682 12:12294583-12294605 TTCCCTCTCTTTGCCTCTTCAGG - Intergenic
1093127321 12:15346361-15346383 ATTTCTCCCATTGCATCCCCAGG + Intronic
1093348049 12:18063922-18063944 TTCCCTCTCCTCCCATCCCCTGG - Intergenic
1093481341 12:19606913-19606935 TTCCTTCTCATTGCATGATCTGG + Intronic
1095557026 12:43519651-43519673 TTCCTTCTCATTTCTTCTCCCGG + Intronic
1095878107 12:47104134-47104156 TTTCCTCTTATGGCATCCTCTGG - Exonic
1096419258 12:51442315-51442337 TACCCTCTCATTGCATCCTGGGG + Intronic
1098067645 12:66636240-66636262 TTCCCTCTCCTGTCAGCCCCTGG - Intronic
1099147128 12:79060479-79060501 TTCCCCCTCCCTGCAGCCCCTGG + Intronic
1100547851 12:95620340-95620362 TTTCCTTTCATTGCATTGCCAGG - Intergenic
1100550476 12:95642394-95642416 TTTGTTCACATTGCATCCCCAGG - Intergenic
1100853635 12:98739174-98739196 TACCTTCTCATTGAAGCCCCTGG + Intronic
1101225328 12:102682486-102682508 TTCCTTCTCTTTTCATCCCCAGG - Intergenic
1101499548 12:105289588-105289610 TTCCCCCTCCCTGCATCCTCTGG - Intronic
1102623444 12:114215317-114215339 TTTCCTTTCATAGCAACCCCTGG - Intergenic
1103217533 12:119213816-119213838 TTGCCTCCCACTGCATCGCCTGG + Intronic
1103865127 12:124045523-124045545 TTCCCTCTCAAAGCGTCCCACGG - Intronic
1104414396 12:128585875-128585897 TTCCCCCTCATCCCAGCCCCTGG - Intronic
1104960959 12:132488606-132488628 TTCCCTGTCAAAGCCTCCCCAGG - Intergenic
1105653601 13:22408269-22408291 TACCCTCTCTTTTCTTCCCCAGG - Intergenic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1106178335 13:27350233-27350255 TTCCCTTTCACTGCCTTCCCTGG + Intergenic
1107160831 13:37225452-37225474 CTCCATCTCATTGGATCTCCTGG + Intergenic
1107238210 13:38198493-38198515 CACTCTCTCCTTGCATCCCCAGG - Intergenic
1110551957 13:76820526-76820548 TCCCCTCTCCTTCCATCCCCTGG - Intergenic
1111082816 13:83334955-83334977 TTTCCTCTCACTTCATCCTCTGG + Intergenic
1112492558 13:99880617-99880639 TTCCCCTTCATTGCAGCCACAGG + Intronic
1113430656 13:110247701-110247723 TTTCCTCTTTTTGCATCCTCTGG - Intronic
1113669674 13:112167062-112167084 TTCTCCCCCATTGCACCCCCTGG - Intergenic
1114814525 14:25941798-25941820 TTCCCTCTTAGGGCATGCCCTGG - Intergenic
1116174350 14:41448189-41448211 TTCCCACTCATTCCCACCCCAGG + Intergenic
1116902984 14:50379255-50379277 TTCCCCCTCCTTGAGTCCCCAGG - Intronic
1117514587 14:56488180-56488202 GTCCCACTCTTTGTATCCCCAGG + Intergenic
1117814366 14:59581958-59581980 TTCTCTCCCACTGCCTCCCCAGG - Intergenic
1118472502 14:66087822-66087844 CTCCCTCTCATTGTCTTCCCTGG - Intergenic
1118557213 14:67038283-67038305 TTCCCTCTCCTCCCAGCCCCTGG - Intronic
1119055127 14:71411631-71411653 CTCCCACTCATTGCAACCTCTGG - Intronic
1119638181 14:76293521-76293543 TTCCTTCTCTGTCCATCCCCAGG + Intergenic
1121267793 14:92615590-92615612 TGCCCTCTCTCTGCATCCTCTGG - Intronic
1121839512 14:97121005-97121027 TTCCCTGACCTTGCAACCCCAGG - Intergenic
1123687087 15:22806412-22806434 TTTCCTCTCATTGGAAACCCTGG - Intronic
1123787978 15:23691230-23691252 TCACTTCTCATTGTATCCCCAGG - Intergenic
1124357617 15:29008220-29008242 TTCCCTCTCCTTCTAGCCCCTGG - Intronic
1124952682 15:34337975-34337997 CGCCCTCTCACTGCACCCCCGGG - Intronic
1125309853 15:38366930-38366952 TTACCTTTCATTTCATCCCCAGG - Intergenic
1127906764 15:63381844-63381866 TTCGCTCTCCTGGCTTCCCCGGG + Exonic
1128128316 15:65209195-65209217 TGCCCTCTGACTGCATCCTCTGG - Intronic
1128593097 15:68920079-68920101 TTCCCTCTCATTGCATCCCCTGG - Intronic
1128662857 15:69514989-69515011 TTCCTCCTCCTTCCATCCCCTGG + Intergenic
1128898621 15:71398709-71398731 TTCCCTCTTTCTGCACCCCCTGG - Intronic
1129637935 15:77342312-77342334 TTCCCTCTCCCTTCAGCCCCTGG + Intronic
1130161627 15:81407468-81407490 TTCCATCTCTTGGCATCTCCTGG - Intergenic
1130196510 15:81784540-81784562 TTCCCCCTCCTTTCTTCCCCTGG - Intergenic
1130872709 15:87983901-87983923 TACCCTGTCATTCCCTCCCCTGG + Intronic
1131083136 15:89553960-89553982 TTCCTTCTCATTCCTTCACCCGG + Intergenic
1132229092 15:100168743-100168765 TCCCCACTCAATGCATCCTCTGG + Intronic
1132303035 15:100788190-100788212 TTCCCTCTCATCCCAGCCCTGGG - Intergenic
1133313591 16:4867736-4867758 CTTCCTCTCACTGCATCCTCTGG - Intronic
1133908327 16:10041644-10041666 TTAACTCTTATTGCATCCCTGGG - Intronic
1135420886 16:22304857-22304879 TTCCCGATCAGTGCAGCCCCAGG + Intronic
1135651520 16:24210468-24210490 ATCACTCTCACTCCATCCCCTGG + Intronic
1137449633 16:48559382-48559404 TTCTCTCTCATTCCATGTCCAGG + Intronic
1138341416 16:56291813-56291835 TGCCCTATCACTGCATCCTCAGG + Intronic
1139151980 16:64393298-64393320 TTCCCTCTCCCCGCAGCCCCCGG + Intergenic
1139316104 16:66070345-66070367 TTTCCTCCTATTCCATCCCCAGG - Intergenic
1139358678 16:66382797-66382819 TTCCCTCAGATTACATCCTCAGG - Intronic
1139641433 16:68294499-68294521 TTCCCTCCCTCTTCATCCCCGGG - Intronic
1140794780 16:78427025-78427047 TACCTTCGCATTGCATCCCTTGG + Intronic
1142883598 17:2898970-2898992 TCCCCTCTCCCTGCAGCCCCTGG + Intronic
1144252097 17:13427898-13427920 TTTCATGTCATCGCATCCCCTGG + Intergenic
1144654957 17:17029479-17029501 GCCCCTCTCATCGCATCCCAGGG - Intergenic
1146683108 17:34822583-34822605 TCCCCTCTGTCTGCATCCCCTGG - Intergenic
1147411152 17:40253438-40253460 TTTCTTTTCTTTGCATCCCCTGG - Intronic
1147458185 17:40551733-40551755 TTCCTTTTCATTTCATCCCCAGG - Intergenic
1148994593 17:51698715-51698737 TTGCCTCTCCTTCCAACCCCTGG + Intronic
1149298761 17:55285077-55285099 TTCCCTGTGATTGCCTCCCATGG + Intronic
1149494425 17:57108162-57108184 TTCCCTCCCATTTCAGCTCCGGG + Intronic
1149768735 17:59302652-59302674 TTTCCCCTCCTTGCAGCCCCTGG - Intergenic
1149893335 17:60409473-60409495 TTCCCTCTGATTGCTTGCTCTGG - Intronic
1151245060 17:72788132-72788154 TAGCCTCTAATTTCATCCCCTGG + Intronic
1151379219 17:73713302-73713324 TTCCCTCTGCTGGGATCCCCCGG - Intergenic
1151436199 17:74099333-74099355 TTCTCTCTCCTTGCTTTCCCTGG - Intergenic
1152132475 17:78485463-78485485 TCCCCTCTCACTGCAGGCCCAGG - Intronic
1155662071 18:28261264-28261286 TTCCCTCTCATGATATCACCTGG + Intergenic
1156864059 18:41869084-41869106 TTCCTTCTCCCTGAATCCCCTGG + Intergenic
1158645101 18:59238907-59238929 TTTCCTCTCCTTCCATCCCCAGG - Intergenic
1160408455 18:78659096-78659118 TTCCCCCTCATTGCATCGAGGGG - Intergenic
1161485532 19:4533752-4533774 TTCCCTCTCCTTTGATCCCTGGG - Intronic
1161705947 19:5821728-5821750 TTCACTCTCATCAGATCCCCAGG + Intergenic
1163446418 19:17349038-17349060 TTCCCTCCCAGCCCATCCCCTGG - Intergenic
1167071675 19:47225864-47225886 TTCCCCCTCCTTGCATCCAAAGG - Intronic
1167655051 19:50758396-50758418 TTGCCTGTCACTGCAGCCCCTGG - Intergenic
1168373738 19:55858289-55858311 ATCACTCTCGTTGAATCCCCGGG - Exonic
925909286 2:8562615-8562637 TTCCCTCTCCTTCCAGCCCCTGG - Intergenic
925919866 2:8631335-8631357 GTACCTCTCATTGCAGACCCCGG + Intergenic
926218027 2:10917238-10917260 TCCTTTCTCATTGCATCCCAGGG + Intergenic
926756281 2:16238690-16238712 TTCCCTCTCCTTTCATTCCTGGG + Intergenic
927133778 2:20081995-20082017 TTCCTTCCCATTGCCTCTCCTGG - Intergenic
928468565 2:31549060-31549082 TTCCCTCTACTTCCAGCCCCTGG - Intronic
929899083 2:45986049-45986071 TTCCCTCTCATTGCCTTGGCAGG - Intronic
931923923 2:67050554-67050576 CTCCCTCTCACTCCAGCCCCTGG - Intergenic
933594943 2:84273957-84273979 TTCCATCACTTTGCATCACCTGG + Intergenic
935650369 2:105377002-105377024 TCCCCTCTCATCCCAGCCCCTGG - Intronic
936270359 2:111044173-111044195 CTCTCTCTCATTGCACCTCCAGG + Intronic
937528069 2:122795463-122795485 TACCCTCTTATTGCTTCCACAGG - Intergenic
938889364 2:135687253-135687275 TTCCCCCTCCCTGCAGCCCCTGG - Intronic
940854195 2:158717079-158717101 TTCCCTCTCACTGTGTCTCCTGG - Intergenic
942680788 2:178476505-178476527 TTCCCTCTCACTTCAGCCTCTGG + Intronic
942877374 2:180817120-180817142 TTCCCTCTCCCTGCATCCTTTGG - Intergenic
943272444 2:185824065-185824087 TTCCCTCTCTCCCCATCCCCTGG - Intronic
943609978 2:190020751-190020773 TTCCCCCTCCTTCCAGCCCCTGG + Intronic
943642999 2:190379467-190379489 TACCCTCTGATTACATCCCTTGG + Intergenic
944276851 2:197848869-197848891 TTCCGTCTCTTTACTTCCCCAGG - Intronic
947491701 2:230601278-230601300 TTCCCCCTCCTCCCATCCCCTGG - Intergenic
947763257 2:232619263-232619285 TTCCCCCTCCTCCCATCCCCTGG - Intronic
947815839 2:233035426-233035448 TTCCATCTCAGTTCTTCCCCAGG - Intergenic
1168806760 20:676259-676281 TTCCCTTTCTTTGCATCCCTGGG - Intergenic
1169118167 20:3080688-3080710 CTCCCTCTCCTTGAGTCCCCTGG - Intergenic
1169144125 20:3241260-3241282 TTCCCTCTCATTCCCTCCCTTGG + Intergenic
1170073434 20:12393252-12393274 TTCCCTCTCTGTCCATCCTCTGG - Intergenic
1170478085 20:16736671-16736693 CTCCCTCAAATTGCATCCCTAGG + Intronic
1170594752 20:17796724-17796746 TTCCCTCCCAGTGCATCCTGGGG + Intergenic
1170608605 20:17893689-17893711 TTCCCTCTCTCTGCAGGCCCTGG - Intergenic
1170784473 20:19455656-19455678 TCCTCTCTCAGAGCATCCCCAGG + Intronic
1172078200 20:32315873-32315895 CACACTCACATTGCATCCCCAGG + Intronic
1172567330 20:35940842-35940864 TTCCATGCCATTGCATCCCCAGG + Exonic
1172740135 20:37160170-37160192 TTCCCTCTCATTGCAGGTACTGG - Exonic
1172882391 20:38210576-38210598 TCTCCCCTCACTGCATCCCCTGG - Exonic
1172997635 20:39083009-39083031 CTGCCTGTCATTGCCTCCCCAGG + Intergenic
1173012259 20:39192812-39192834 TTCCCTCTCATTTCATCTCCTGG + Intergenic
1173063361 20:39683184-39683206 TTTCCTCTCCTTCCATCCACAGG - Intergenic
1174294132 20:49532326-49532348 TTCCCTCTAAATCTATCCCCAGG - Intronic
1182649178 22:31836887-31836909 TTCCCTCCCCTTCCCTCCCCTGG + Intronic
1183123923 22:35756332-35756354 TTCCCTCTCCTCGCATGTCCTGG - Intronic
1183362961 22:37392241-37392263 TTCTCTCACATTTCATCCTCAGG + Intronic
1183591793 22:38783368-38783390 TTCCCTCCCACTGCATACACGGG + Intronic
1184843500 22:47066505-47066527 GTCCCTCTGTTTGCATCCCTTGG + Intronic
949579253 3:5370802-5370824 TTCCCCCTCCCTCCATCCCCTGG + Intergenic
949857428 3:8474720-8474742 TTCCCTCTCCCTGCTGCCCCTGG - Intergenic
950235052 3:11312003-11312025 TTCCCCCTCTTCTCATCCCCTGG - Intronic
954227837 3:49194236-49194258 TTCCCTCTCATTGCCTAGACTGG - Intergenic
954745260 3:52784179-52784201 TTCCATCTCAGAGCATCTCCAGG - Intronic
955058013 3:55473514-55473536 TTCCCGCTCTTTCCTTCCCCTGG - Intronic
956600200 3:71012779-71012801 TTCTCTCTCATTCAAGCCCCAGG - Intronic
957685521 3:83500700-83500722 TTCCCTTACACTCCATCCCCTGG + Intergenic
959116706 3:102187006-102187028 TTGTCTCTAATTGCATCCCGGGG - Intronic
960016212 3:112891191-112891213 TTCCCTCTCCCTGCAGTCCCTGG + Intergenic
960453774 3:117844001-117844023 TTCCCCCTGAAAGCATCCCCCGG - Intergenic
960827211 3:121801730-121801752 TTCCCTATCATTCTATGCCCAGG + Intronic
961531865 3:127544911-127544933 TTTCCTCTAATTGGATCCCCTGG + Intergenic
961845390 3:129758828-129758850 TTCCCTCTCTTCCCAGCCCCTGG + Intronic
963077889 3:141364645-141364667 TTCCCTCTTATTGCCTCAGCTGG - Intronic
963104364 3:141633414-141633436 TTCCCTCACATTGGTTGCCCTGG + Intergenic
963355041 3:144200713-144200735 TTCCCTCCCACTGCAGCCACAGG - Intergenic
963945621 3:151143111-151143133 TTCCCTCTCATTCCCTGCTCCGG - Intronic
969343935 4:6559651-6559673 TTCCTTCTAATTGTTTCCCCAGG - Intronic
970007778 4:11427703-11427725 TTCCATCTCTTTCCCTCCCCTGG - Intronic
971189986 4:24418452-24418474 TTGCTTCTCATTGCATCTCCAGG - Intergenic
971758889 4:30738008-30738030 TGCCTTCTCTTTGCATCCTCAGG + Intronic
972579908 4:40385963-40385985 TCCCCTCTCCTTCCCTCCCCTGG - Intergenic
978141275 4:105319938-105319960 TTCCCTCTCACCCCAGCCCCTGG - Intergenic
978925296 4:114235287-114235309 TTTCCTCTCATTAGATACCCAGG - Intergenic
980631774 4:135446010-135446032 TTCCCCCTCATCCCAGCCCCTGG - Intergenic
980894867 4:138852432-138852454 TTCAGTCTCATTGCATCTTCAGG + Intergenic
983288204 4:165766206-165766228 TTTCCTTTCATTGTATCTCCAGG + Intergenic
984326422 4:178258904-178258926 TTGCCTCTTATTGCAACTCCTGG - Intergenic
985869987 5:2546803-2546825 TGTTCTCTCATTCCATCCCCCGG - Intergenic
986047006 5:4048477-4048499 TTTCCTCTCATTTCATCCTTTGG + Intergenic
987471022 5:18327677-18327699 TTCCTTCCCATTGCTGCCCCTGG - Intergenic
988615023 5:32766988-32767010 TGCCCTCTCATTCCCTCTCCAGG + Intronic
990255820 5:53967767-53967789 TTCCCCAGCATTCCATCCCCTGG - Intronic
994009728 5:94887224-94887246 TTATGTCTCATTGAATCCCCAGG + Intronic
996160481 5:120156047-120156069 TTCCCTCTCCTACCAGCCCCTGG + Intergenic
997706862 5:135963644-135963666 TTCCATCTCATTACATTCCGGGG - Intergenic
998339300 5:141403009-141403031 TGGCCTCCCATAGCATCCCCAGG - Exonic
998388597 5:141772700-141772722 TCCCATCTGATTGCATCCCAAGG - Intergenic
999276296 5:150332789-150332811 TTCCCTCTCATGGTCTTCCCCGG + Intronic
1005898526 6:30198001-30198023 TTCCCTCTCAGTTCTTACCCTGG + Intronic
1008584004 6:52932683-52932705 TTCTCCCTCACAGCATCCCCAGG - Intergenic
1009849622 6:69179679-69179701 TTCCCTTTCATTCCTTCCCTGGG + Intronic
1012959001 6:105602500-105602522 TTCCCTTTCATCACAACCCCAGG + Intergenic
1015720745 6:136238512-136238534 TTCCCTCTCCCCTCATCCCCTGG - Intronic
1017382255 6:153844474-153844496 TTCACTCACATTGCATTCCCAGG - Intergenic
1017970909 6:159311960-159311982 TTTCCATTCATTGCACCCCCTGG - Intergenic
1019161429 6:170069346-170069368 TTCCCACACACTCCATCCCCAGG + Intergenic
1021504556 7:21367461-21367483 TTCCCTCTCTTTCCAGCCTCTGG - Intergenic
1022021048 7:26399306-26399328 TTCCTCCTCATTGCCTCACCAGG - Intergenic
1022688649 7:32622725-32622747 TTCGCTCTCATTGCCTACACTGG - Intergenic
1024154028 7:46601984-46602006 TTTCCTCTCCTTTCTTCCCCTGG - Intergenic
1026981681 7:74530304-74530326 TGCCCCATCATTGCCTCCCCAGG - Intronic
1027201353 7:76065675-76065697 TTCCCTCCTACTGCTTCCCCTGG - Intronic
1027655461 7:80925038-80925060 TTCTCGCTCATTCCTTCCCCTGG + Intergenic
1029018530 7:97339549-97339571 TTCCCATTCATTCCAACCCCTGG + Intergenic
1029021853 7:97372461-97372483 TTCCCTCTCCCTCCAGCCCCTGG + Intergenic
1030678050 7:112405491-112405513 TTCCCCCTCCTTCCAGCCCCTGG - Intergenic
1031945014 7:127830502-127830524 TTCCCTCACTTTTCTTCCCCTGG + Intronic
1031965597 7:128026091-128026113 TTTCCTCTGAATGCATACCCAGG + Intronic
1033709694 7:143929362-143929384 TTCCCCCTCCTAGCATCCTCTGG - Intergenic
1033869301 7:145730696-145730718 TTCCCTCTCCTTGCTCCCCAGGG - Intergenic
1035797620 8:2373832-2373854 ATCCCTCTCAATCCATCACCTGG + Intergenic
1036389941 8:8316716-8316738 TTCCTGCTAAGTGCATCCCCAGG + Intergenic
1038657144 8:29463538-29463560 TTCCCTCTCCCTGCGGCCCCTGG + Intergenic
1039312311 8:36330375-36330397 TTACCTGTCAGTCCATCCCCAGG - Intergenic
1041093788 8:54329237-54329259 TTCCCTCTCCTCGCAGCCCGTGG + Intergenic
1041822293 8:62050712-62050734 TTCACTCTTGTTGCCTCCCCAGG - Intergenic
1042129135 8:65569631-65569653 TTTCTTCTCATTGCACTCCCTGG - Intergenic
1042183199 8:66112608-66112630 TTCCCTCTCTTTGCTTAGCCGGG + Intergenic
1042626368 8:70762286-70762308 TTCCCTCTTTTTCCAGCCCCTGG + Intronic
1048381792 8:133871834-133871856 GTCCCTCTCACTGCAGCCCATGG - Intergenic
1048442361 8:134469376-134469398 TTCCTTCTCACTGTTTCCCCTGG + Intergenic
1049044464 8:140138517-140138539 TGTGCTCTCACTGCATCCCCCGG + Intronic
1049162132 8:141104386-141104408 CTCTCTCTCCTTTCATCCCCTGG + Intergenic
1049342171 8:142119000-142119022 TCCCCTCTCCTCCCATCCCCGGG + Intergenic
1051694568 9:19754226-19754248 GCCCCACTCATTGCCTCCCCAGG + Intronic
1051751972 9:20351941-20351963 TTCACCCTAATTGCATTCCCAGG - Intronic
1054828667 9:69599055-69599077 TTCCCTCTCTTCCCAGCCCCTGG - Intronic
1054937883 9:70708821-70708843 TTCCCCCTCTCTGCAGCCCCTGG + Intronic
1054939574 9:70726814-70726836 TTCCCCCTCTCTGCAGCCCCTGG + Intronic
1055977280 9:81967688-81967710 TTTCCTCCCATTTCAACCCCAGG - Intergenic
1057311198 9:93944326-93944348 ATCCCACTCATTGCATGTCCAGG + Intergenic
1058211945 9:102179949-102179971 TTCCCTTTCATTGCTTTTCCTGG - Intergenic
1059370969 9:113835149-113835171 TTCCCTCTCCCTGCAGCCCCTGG - Intergenic
1059411396 9:114134625-114134647 TGGCCTCTCAAGGCATCCCCTGG + Intergenic
1059431103 9:114250819-114250841 TTCCCTTTCCTGGCATCCCTTGG + Intronic
1060758545 9:126229689-126229711 TTCCCTGCCATTCCAACCCCAGG - Intergenic
1062019006 9:134307445-134307467 TTTCCTCTCAGGGCAGCCCCGGG - Intergenic
1062353423 9:136150128-136150150 TGCCCTCTCTCTGCAGCCCCGGG + Intergenic
1203751041 Un_GL000218v1:80687-80709 TTCCCCCTCCTTCCACCCCCTGG - Intergenic
1187106333 X:16246231-16246253 TTCCCTCTCTCTCCAGCCCCTGG - Intergenic
1189198328 X:39170052-39170074 TTCCTTCCCTTAGCATCCCCTGG - Intergenic
1189202362 X:39207923-39207945 TTCCCTTTCATTTCATCCTCTGG + Intergenic
1190258367 X:48782061-48782083 TTCCCTCTCCTCCCATCCCCGGG - Intergenic
1191052107 X:56205484-56205506 TTCACCATCATTGCATCCCAGGG + Intergenic
1192549863 X:72045273-72045295 ATCCCTCCCATTGTATGCCCAGG - Intergenic
1193396893 X:80995123-80995145 TTACCTATCTTTGCATCCCTGGG - Intergenic
1196031641 X:111099370-111099392 TTGCTCCTCATTGCATCCCCTGG - Intronic
1196129421 X:112138232-112138254 TTCCCTCTCCTTCAATCCCCTGG - Intergenic
1196694430 X:118595895-118595917 TTCCCTCTCCTCCCAGCCCCTGG - Intronic
1197220095 X:123904001-123904023 TTCCCTCTCTTCCCAACCCCTGG + Intronic
1198608407 X:138370190-138370212 TTCCCTCTCTTCCCAGCCCCTGG + Intergenic
1198890315 X:141387533-141387555 TTCACTGTCTTTCCATCCCCAGG + Intergenic
1199868585 X:151876318-151876340 TTCCTTTTCACTGCATCCCAAGG - Intergenic
1202070929 Y:20990719-20990741 TTCCCTCCCATTTCCTCCCTTGG - Intergenic