ID: 1128594136

View in Genome Browser
Species Human (GRCh38)
Location 15:68929342-68929364
Sequence GCTAGGTTTTGAGCTGGGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128594136_1128594139 -7 Left 1128594136 15:68929342-68929364 CCGTTCCCAGCTCAAAACCTAGC 0: 1
1: 0
2: 1
3: 22
4: 221
Right 1128594139 15:68929358-68929380 ACCTAGCAGTACTCTAGTACTGG 0: 1
1: 0
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128594136 Original CRISPR GCTAGGTTTTGAGCTGGGAA CGG (reversed) Intronic
902454381 1:16521404-16521426 GGTAGGTCAAGAGCTGGGAAAGG + Intergenic
903598589 1:24516423-24516445 GGTAGGATTTTAGCAGGGAAGGG + Intronic
904014311 1:27408329-27408351 ACTAGGTTTTCAGCTGCGCAGGG - Exonic
905975261 1:42169578-42169600 GCTAAGTTTTGTGATGGCAAAGG - Intergenic
906107600 1:43304279-43304301 GCTGGGATTTGAGGTGGGAGAGG - Intronic
908808134 1:67951890-67951912 GCTAGATATGGAGCTGGGGATGG - Intergenic
910591803 1:88934114-88934136 GGTAGGCTTTGAGGTGAGAATGG + Intergenic
912797686 1:112702806-112702828 TTGAGGTTTTGAGCTGTGAAAGG - Intronic
912841574 1:113043866-113043888 GCTATAGTCTGAGCTGGGAAGGG - Intergenic
915219274 1:154361135-154361157 GACAGGTCTTGAGCTGGGCATGG + Intergenic
917432601 1:174986237-174986259 GATTGGTTTTGTGCTGGGCACGG - Intronic
919525427 1:198642859-198642881 GCTAGGCCTGGAGCTGGGAAGGG + Intronic
922084510 1:222333111-222333133 ACCAGGTTCTGAGCTGGGAGTGG - Intergenic
922580865 1:226696893-226696915 GCTGGGTTTTTTCCTGGGAATGG - Intronic
1063135191 10:3210156-3210178 GCTTGATTTTGAGCTGGAACAGG - Intergenic
1063866506 10:10370947-10370969 GCTAGCTTATGAGATGGGAATGG - Intergenic
1064357307 10:14631581-14631603 GCTAGGTTTGGGGCGGGGCATGG - Intronic
1065094086 10:22263656-22263678 GGTAGGTCCTGAGCGGGGAATGG - Intergenic
1065958566 10:30714767-30714789 GGCAGGTTTTGGGCTGGGCATGG - Intergenic
1066623880 10:37385912-37385934 GCTTGGTCTTGAGCTGGGGAGGG - Intergenic
1068405540 10:56584044-56584066 TCTACTTTTGGAGCTGGGAATGG - Intergenic
1071000447 10:80825352-80825374 TCTTTGTTTTCAGCTGGGAAGGG + Intergenic
1071064440 10:81614256-81614278 ACTTGGTCTTGAGCTGGGCATGG + Intergenic
1075030489 10:119021411-119021433 CCTGGGTTTTGAGAAGGGAAAGG + Intergenic
1076167135 10:128291896-128291918 GCAAGGTTTGGAGCAGGGATGGG - Intergenic
1077659662 11:4056298-4056320 GCTAGGGCTTGGGCTGGGAGTGG + Intronic
1077910220 11:6566588-6566610 GCTAGGTTGTGAACTGCTAAAGG + Exonic
1078020508 11:7652630-7652652 GCCAGGTGCTGAGATGGGAAAGG + Intronic
1079970670 11:27031852-27031874 GCTAGGTTTGGCCCTGGGAGAGG - Intergenic
1083343748 11:61975346-61975368 GCCAGGTGCTGAGGTGGGAAAGG - Intergenic
1083405101 11:62451349-62451371 GCCAGGCTGTCAGCTGGGAAGGG - Intronic
1084480255 11:69415924-69415946 GCTGGGCTGCGAGCTGGGAAGGG - Intergenic
1085037739 11:73309893-73309915 CCTAGCTTTGGAGCTGGGGAAGG + Exonic
1085071087 11:73546439-73546461 GCTAGCTGTTGGGCTGGGCACGG + Intronic
1085174085 11:74471572-74471594 GCTAGGCTTGGTGCTGGGAATGG - Intergenic
1085401848 11:76240193-76240215 GGGAGGTTGTGAGCGGGGAAGGG + Intergenic
1085793064 11:79512786-79512808 GCAAGGTTTTGAGTGGGGATTGG + Intergenic
1086058102 11:82672025-82672047 GCTAGAATTGGGGCTGGGAATGG + Intergenic
1086833351 11:91593225-91593247 GCTTGGTCTTGAGCTGGGTGGGG - Intergenic
1088922972 11:114274942-114274964 GCTGGGATTGGAGTTGGGAATGG + Intronic
1089208282 11:116782978-116783000 GCTAGAATTTGAACTGGGAATGG - Exonic
1089496394 11:118910445-118910467 GCTAGGCCTCGAGCTGGGGACGG - Exonic
1091445691 12:543221-543243 GCTGGGTGCTGGGCTGGGAATGG + Intronic
1091552161 12:1544584-1544606 TCTAGTTTTTGGGCTGGGCACGG + Intronic
1092471553 12:8786359-8786381 GCTAGGTTTTGAACTTGGATGGG - Intergenic
1092731691 12:11540623-11540645 GCTGGGTCTAGAACTGGGAATGG + Intergenic
1092732268 12:11545988-11546010 GCCAGGTTGTGGGCTGGGTAGGG + Intergenic
1095395332 12:41756533-41756555 GCTGGGTTTTGAGCTTGCATAGG - Intergenic
1098872895 12:75836442-75836464 GCTAAATTTTCAGCTGGGATTGG - Intergenic
1102567494 12:113806119-113806141 GCATGGTTTTGGGCTGGAAAGGG - Intergenic
1102743590 12:115230324-115230346 GGTAGGGTCTGAGCTGGGCAAGG - Intergenic
1104205142 12:126631790-126631812 GCTCTGTTCTGAGCTAGGAAAGG + Intergenic
1104402028 12:128484280-128484302 CCAAGGTTTTGAACTTGGAATGG + Intronic
1106623871 13:31398449-31398471 GCAATGTTTTAAGCAGGGAAGGG + Intergenic
1107561756 13:41563197-41563219 GCTGGGGTTTGACCTGGAAATGG - Intergenic
1108280286 13:48854557-48854579 GATAAGTGTTGAGCTGGGCACGG + Intergenic
1110267681 13:73557008-73557030 GATCTGTTTTGAGTTGGGAAAGG - Intergenic
1111326870 13:86709472-86709494 GCTCGTTTTTGATCTGGCAATGG - Intergenic
1113150531 13:107258534-107258556 GTTAGGTTGTGGGCTGGGGAAGG - Intronic
1114512382 14:23273190-23273212 GCTTGGTTGGGAGTTGGGAATGG + Exonic
1115894772 14:38074147-38074169 GCTAGGTTTTGCTGTGGTAATGG + Intergenic
1121119103 14:91364719-91364741 TCTGGGTTGGGAGCTGGGAATGG - Intronic
1122246038 14:100404249-100404271 GCAAGGTGCGGAGCTGGGAATGG + Intronic
1124253453 15:28122412-28122434 CTTAGGCTTTGAGCTGGGCAAGG - Intronic
1128514091 15:68331467-68331489 GGTTGGTTTTGAGGTGGGCATGG + Intronic
1128594136 15:68929342-68929364 GCTAGGTTTTGAGCTGGGAACGG - Intronic
1128628989 15:69243928-69243950 GCTATTTTTTGGGCTGGGCATGG - Intronic
1128750369 15:70144348-70144370 GCTGGGTTTGGAGCTGGGTTTGG - Intergenic
1129302533 15:74633811-74633833 TCTAGGCTGAGAGCTGGGAAGGG - Intronic
1131014106 15:89043268-89043290 GCTGGGGTTTGGGCTGGGCATGG + Intergenic
1131370115 15:91873796-91873818 GCTAGGTATAGAGCTAGAAATGG - Intronic
1133162718 16:3922573-3922595 GGGAGGTGTTGCGCTGGGAAGGG + Intergenic
1134514190 16:14873535-14873557 GCCAGGTTTTTAGCTGGGGGTGG + Intronic
1134701832 16:16272034-16272056 GCCAGGTTTTTAGCTGGGGGTGG + Intronic
1134969998 16:18522616-18522638 GCCAGGTTTTTAGCTGGGGGTGG - Intronic
1136373363 16:29849674-29849696 GTTAGGTTTGTTGCTGGGAAGGG - Intergenic
1136574238 16:31113778-31113800 AGTGGGTTTTGAGCTGGGAAGGG + Intergenic
1136638143 16:31538917-31538939 GCTGGCTTTCGAGCTGGAAAGGG - Intergenic
1137265464 16:46865549-46865571 TATAGGTTTTGAGCTGGGTATGG - Intergenic
1137437796 16:48471677-48471699 GCCAGGGTTTGGGCTGGGGATGG - Intergenic
1138339675 16:56280504-56280526 GAGAGATTTTGAGCTGGGATGGG + Intronic
1138776536 16:59729948-59729970 GCAAGTTTATCAGCTGGGAAGGG - Intronic
1141477569 16:84284011-84284033 GCTCGGTTTGGTGCGGGGAAGGG + Intergenic
1143853993 17:9834963-9834985 GCTAGGTTATGAGCTGGCTTGGG - Intronic
1144219398 17:13086400-13086422 CCTGGGTTTTGTGCAGGGAATGG - Intergenic
1144957585 17:19027000-19027022 GCTGGCTATAGAGCTGGGAAGGG - Intronic
1144977571 17:19147516-19147538 GCTGGCTATAGAGCTGGGAAGGG + Intronic
1146541939 17:33703685-33703707 GGTAGGTTTTAAGCAGGGGAAGG + Intronic
1147013757 17:37473618-37473640 GATTGGTATTCAGCTGGGAATGG - Intronic
1147747929 17:42707027-42707049 GCTCAGCTTTGAGTTGGGAAGGG + Intronic
1148071439 17:44911109-44911131 GCTGGGCATTGAGGTGGGAAGGG + Intronic
1149524613 17:57345134-57345156 CCTAGGTCTTTAGCTGGGATGGG - Intronic
1149639186 17:58192232-58192254 GCTGGGCTTTGAGCTGGGTATGG + Intergenic
1151399054 17:73843705-73843727 GCTGGATTCTGAGCTGGGACTGG + Intergenic
1151459102 17:74244131-74244153 TCTAGGTTAGGAGCTGGGACCGG - Intronic
1151844296 17:76640464-76640486 GCGATGTTTTGGGGTGGGAATGG - Intronic
1154122832 18:11665430-11665452 CTTGGGTTTGGAGCTGGGAAGGG - Intergenic
1155262941 18:24062274-24062296 GCTAATATTTGAGCAGGGAAAGG + Intronic
1157964603 18:52193635-52193657 CATGGGTTTGGAGCTGGGAAAGG - Intergenic
1160491508 18:79340842-79340864 GCTAGTTTTTTAGTTGGAAACGG - Intronic
1160780456 19:875642-875664 GCTGGGTTCTCAGCTGGGAGCGG + Intronic
1161278012 19:3429732-3429754 GGTAGGTTTGGAGGTGGGACAGG - Intronic
1165503026 19:36205236-36205258 GGTAGGTTTTCAGCCGGGCACGG + Intronic
1166333972 19:42094491-42094513 GAGTGGTTTTGAGCTGGGGAAGG - Intronic
1166858364 19:45794759-45794781 GATGGGTTTTGAGCAGGGGAGGG - Intergenic
1166865715 19:45835528-45835550 ACAAGGTTTTGAGGTGGGAGGGG + Intronic
925910323 2:8569570-8569592 GCTAGTTTTCCAGCTGGCAATGG - Intergenic
926658376 2:15435665-15435687 GCTGGAATTTGAGCTGGAAAAGG - Intronic
927643074 2:24857867-24857889 GCTATGTCAGGAGCTGGGAAGGG - Intronic
928337985 2:30414477-30414499 GCTAAGGTTTCAGCTGGGAATGG - Intergenic
928780873 2:34819008-34819030 GCTATGTTTGGTACTGGGAAGGG + Intergenic
932158265 2:69437704-69437726 GCTAGGTTTTTAGCTGGTGCTGG + Intergenic
932356344 2:71071440-71071462 GCCAGCTTTGGAGCTTGGAAGGG - Intronic
935179253 2:100675503-100675525 ACTAGGTTTGGAGCAGGGTATGG - Intergenic
936947672 2:117945253-117945275 GCTGGCTTCTCAGCTGGGAAGGG - Intronic
937237593 2:120440197-120440219 GCTGGGTTTAGAGCAGGGCAGGG - Intergenic
937972998 2:127564660-127564682 GCTAGGTGGTGAGCAGGGAAGGG + Intronic
938255031 2:129851023-129851045 GCTTGGCTCTGAGCTGGGACAGG - Intergenic
938638248 2:133252196-133252218 GCTTGGTTTTCAGATGGGAGAGG + Intronic
942692017 2:178595764-178595786 GTTAGGTTGTGAGCTAGGAATGG + Exonic
945410173 2:209498185-209498207 GCTAGGTTTTGAACTTGCATGGG - Intronic
948098910 2:235358337-235358359 GCTCGGGTTTGAGCTGGATAAGG + Intergenic
948540277 2:238686328-238686350 GCTACTTCTTGAGCTGGAAATGG + Intergenic
948731407 2:239966147-239966169 GCGAGGCCTGGAGCTGGGAAGGG + Intronic
948812965 2:240494367-240494389 ACTTGGTTGTGAGCTGGGCATGG - Intronic
1170948101 20:20909987-20910009 GCGAGGGGTTGAGCAGGGAAGGG + Intergenic
1171051672 20:21865203-21865225 ACTATGTTTTCAGCTGGGAAAGG + Intergenic
1172093873 20:32451322-32451344 GCTAGGTTTTAAGCACAGAAGGG - Intronic
1172276632 20:33683480-33683502 GTTAAGTTTTCAGCTGGGCATGG + Intronic
1173201417 20:40957874-40957896 CCTTGGCTTTGAGCTAGGAAAGG + Intergenic
1176105415 20:63383654-63383676 GCTGGGGTTGGAGGTGGGAAAGG + Intergenic
1177869566 21:26554887-26554909 TCTGGGTTTTAAGCTGGGCATGG - Intronic
1178233583 21:30815459-30815481 GCTAGGTTTTGTGCTGCAGAAGG - Intergenic
1178767870 21:35471407-35471429 GCTTGATATTGACCTGGGAAAGG + Intronic
1180704950 22:17803662-17803684 GCTCTGTTTTGAGCTGGAAAAGG + Intronic
1181733737 22:24866150-24866172 GCAAGGTTTTGAGCTGGAAATGG + Intronic
1183195623 22:36351671-36351693 GCAAGGTCTTGAGCAGGGCAGGG - Intronic
1183727258 22:39596639-39596661 GCAGGGTTTTGTGCTGGGGAGGG + Intronic
1183779295 22:39988576-39988598 GCAGGGTTTTGTGCAGGGAAAGG + Intergenic
1184047384 22:41979823-41979845 GCTGGGTTTAGGGGTGGGAAGGG + Intronic
952720537 3:36527937-36527959 GCTAGGTTTTGAGAGGGTATTGG + Intronic
954456165 3:50600915-50600937 GGCAGGTTCTGAGCAGGGAAGGG + Intergenic
955048457 3:55384644-55384666 GCCAGTTTTTGAGCTGGGAGGGG - Intergenic
955839779 3:63099476-63099498 GCTGGGTTTTGAGCCTGGAACGG + Intergenic
956191842 3:66615525-66615547 TCAAGGTTTTGAACTGAGAAGGG + Intergenic
957978401 3:87476017-87476039 GCTAGGTTTTGAGATGGAAGGGG - Intergenic
958771670 3:98433359-98433381 GCTAGGACTTGAGGTGGGAGGGG + Intergenic
960377161 3:116917284-116917306 ACTAGCTTTTTAGCTGTGAAGGG - Intronic
960463199 3:117962368-117962390 TCTAGTTTTTGTGGTGGGAAGGG + Intergenic
964341902 3:155717056-155717078 GCTGGGTTTTGAGCTTGCATGGG - Intronic
965281782 3:166764281-166764303 GCTTGGTTTTGAAGTGTGAAAGG - Intergenic
966790854 3:183668001-183668023 ACTGTGTTTTGAGCTGGGCATGG - Intronic
966869073 3:184278309-184278331 TCCAGGTGATGAGCTGGGAAAGG + Exonic
966954937 3:184866382-184866404 CCTGGGTTTGGAGGTGGGAATGG + Intronic
968709352 4:2101868-2101890 GCTTGGTCTTGAGCTGGGTAGGG + Intronic
969033045 4:4228487-4228509 GCTGGGTTTTCAGCTATGAAAGG + Intergenic
969202477 4:5616850-5616872 GCTTGGTTTTCAGATGGAAATGG - Intronic
971100415 4:23460140-23460162 GCTAGGGTTTGGGGTGGGAGTGG - Intergenic
971170179 4:24225719-24225741 TCTAGGTGCTGAGATGGGAAAGG + Intergenic
971534802 4:27735477-27735499 GCTAGGGTTTGAGCTAGGAGAGG + Intergenic
971591433 4:28473938-28473960 GCTTGGTTTTGAAATGTGAAAGG + Intergenic
972349851 4:38226424-38226446 GGAAGGTTTTGAGCAGGGGATGG - Intergenic
973697950 4:53509125-53509147 GCTAGGTTTTGGTCAGGAAATGG + Intronic
973855865 4:55009276-55009298 GCTAGATGTTGTGCTGGTAAGGG - Intergenic
974571119 4:63650043-63650065 GGTAGGTTTTGAGGTCGAAATGG + Intergenic
980810133 4:137866957-137866979 GCTGCCTTTTTAGCTGGGAAGGG - Intergenic
982394989 4:154906862-154906884 GCTAGGTATTCAACTAGGAAAGG - Intergenic
983419861 4:167503421-167503443 GCTAGGTTTTGATATTAGAATGG + Intergenic
984624348 4:181988866-181988888 GATATGTTTTGAGCAGGGAGAGG - Intergenic
984677174 4:182563122-182563144 GTTAGGCTTAGAGCTGGGCATGG + Intronic
987042048 5:14072074-14072096 GCCAGGTGATGATCTGGGAAGGG - Intergenic
988272266 5:29032466-29032488 GCTGGGTTTTGAGCTTGCATGGG - Intergenic
988628219 5:32900243-32900265 GCTTGGTTTTGAAATGTGAAAGG - Intergenic
988923302 5:35963798-35963820 GCCAGGTACCGAGCTGGGAAGGG + Intronic
989413866 5:41151077-41151099 GATAGGTTTTAAGCAGGGAGTGG + Intronic
990520247 5:56572821-56572843 GCTGGGTTTTGAGCTTGCATGGG - Intronic
990622111 5:57571005-57571027 GCCAGGTTTTGAACTCAGAAAGG - Intergenic
990707769 5:58549226-58549248 GCCAGGGTTTGAGTTGGCAAGGG + Intronic
991964690 5:72079389-72079411 GCAAGGATTTCTGCTGGGAAGGG + Intergenic
992375370 5:76183313-76183335 GGTAGGTTCTCAGCTGGGCATGG - Intronic
992617233 5:78556426-78556448 GCTAGTTTGTGAGGTGAGAATGG - Intronic
992877788 5:81074986-81075008 GTCAGGTTTTGAGCAGAGAAGGG + Intronic
994936129 5:106255644-106255666 GCTAGGTTTTGAACTTGCATGGG + Intergenic
995117800 5:108501045-108501067 GCTGGGTTTTGAGCTTGCATGGG + Intergenic
995240873 5:109884563-109884585 GCCAGGTCTTGAGCTGAGGAGGG + Exonic
996338609 5:122411924-122411946 GCCTGGTTTTGAGCAGGGAGTGG - Intronic
996971684 5:129377121-129377143 GCTAGGTTTTGAAGTAGGAAGGG - Intergenic
997273474 5:132562234-132562256 GGGAGATTTTGAGCAGGGAAAGG + Intronic
998839989 5:146242973-146242995 GATAGCTTTTGGGCTGGGCATGG + Intronic
999030536 5:148285731-148285753 GAAAGGTATTGAGATGGGAATGG + Intronic
999787545 5:154905645-154905667 GCTAGTTTGGGAGGTGGGAAAGG - Intronic
999976862 5:156920651-156920673 GCAAGTGTTTGACCTGGGAAAGG - Intronic
1000225724 5:159260161-159260183 GCTAGGTTCTGAGAATGGAAAGG + Intergenic
1001491770 5:172161031-172161053 GCTAGACTTTGAGCTGGCCAGGG - Intronic
1002613787 5:180437801-180437823 CCTAGGATTTGGGCGGGGAATGG - Intergenic
1006931248 6:37689951-37689973 GCAGGGTTTTGAGCAGAGAAGGG - Intronic
1007608356 6:43132317-43132339 GGGAGGGTTTGTGCTGGGAAAGG + Intronic
1012505790 6:99944767-99944789 GAAAGGTTTTCAGCTGGGGAGGG - Intronic
1014341832 6:120218924-120218946 GCAAGGTTTTGAGCTAAGTATGG - Intergenic
1014776645 6:125518536-125518558 CCTAGGTTATGTGCTAGGAAAGG - Intergenic
1016829402 6:148418664-148418686 GCTAGGTCTTGAGATGTTAATGG + Intronic
1017648506 6:156561043-156561065 TCTAAGTTTGGAGATGGGAAGGG + Intergenic
1018022514 6:159775160-159775182 GCTACATTTTCAGCTGGGAAAGG - Exonic
1018531020 6:164763449-164763471 GCTAGGTTTTGGGCTTGCACGGG + Intergenic
1018641650 6:165909319-165909341 GGCAGGTCTTGAGCTGGCAATGG + Intronic
1019403175 7:867989-868011 GCTAGGCTTTGGGCTGGCAAAGG + Intronic
1019620007 7:1987289-1987311 GCCAGGTTCTGTGCTGGCAATGG - Intronic
1020045320 7:5036260-5036282 GCTTGGTTTTGAGCTGAGTGCGG - Intronic
1021939200 7:25663094-25663116 TCCAGGCTTTGATCTGGGAAAGG - Intergenic
1023148391 7:37175540-37175562 GTTGGGTTTTGAGTTGGGCATGG - Intronic
1026430879 7:70346219-70346241 GATAGGATTTAAGGTGGGAAAGG - Intronic
1027949011 7:84788695-84788717 GCGAGGATGTGAGCAGGGAAGGG + Intergenic
1028214307 7:88113009-88113031 GTTCAGTTTTGAGCTGGGCATGG - Intronic
1029696893 7:102219443-102219465 GATAGGTTTGGGGCTGGCAAGGG + Intronic
1032082367 7:128866073-128866095 GCTCGGCATTGGGCTGGGAAGGG + Intronic
1032493500 7:132343029-132343051 CCTAGGGTTTGATCTTGGAAAGG - Intronic
1033560623 7:142527240-142527262 TCTAGGTGTGGATCTGGGAAGGG - Intergenic
1035957287 8:4094927-4094949 TGAAGGTTTTGAACTGGGAATGG + Intronic
1037619756 8:20553308-20553330 GGGAGATTTTGAGCTGGGACTGG + Intergenic
1037639512 8:20730026-20730048 GCTAAGTTTTGAGGAGGCAAAGG - Intergenic
1038456123 8:27672863-27672885 GAAAGGCTTTGAGCAGGGAAGGG - Exonic
1039098052 8:33908254-33908276 GTTAGATTTAGAGCTTGGAAGGG - Intergenic
1040103495 8:43525298-43525320 GCTGGGTTTTGGACTTGGAAGGG + Intergenic
1040518060 8:48150576-48150598 GCCAGGCTTTGTGCTGGGCACGG + Intergenic
1040684950 8:49860638-49860660 GCAGGGTTTTGTGCTGGGGAAGG - Intergenic
1043587017 8:81781378-81781400 GCTAGGGTTTGGGCTGTGTATGG + Intergenic
1045029705 8:98123458-98123480 CCTTGTTTTTGAGCTTGGAAAGG - Exonic
1045526914 8:102948791-102948813 GTTGGGTGTTGAGCTGGGATTGG + Intronic
1045641501 8:104256710-104256732 GCTAGGTGCTGTGCTGGGTATGG - Intergenic
1047330753 8:123884707-123884729 CCCAGGTTTGGTGCTGGGAATGG + Intronic
1048121538 8:131587275-131587297 GCTAGGTTCTGGGATGGTAATGG - Intergenic
1050146272 9:2571303-2571325 GCTAGGTATTGAACTAGGCAAGG - Intergenic
1051994357 9:23196812-23196834 GAGAGGTTTTCAGCTGGAAAAGG + Intergenic
1055709198 9:79040199-79040221 GCTAGGTTTGGGGATGGTAAAGG + Intergenic
1057165961 9:92925634-92925656 GCGAGGCTTGGAGGTGGGAATGG + Intergenic
1057941707 9:99290719-99290741 GCCAGGCTGTGTGCTGGGAAAGG - Intergenic
1061431422 9:130533666-130533688 GGAAGGTTCTGAGGTGGGAAGGG - Intergenic
1186299781 X:8187799-8187821 GCCAGGATTTCAGCTGGGAGGGG - Intergenic
1186975354 X:14896457-14896479 ACCAGGTTATGACCTGGGAAGGG - Intronic
1187859029 X:23664439-23664461 TCTAAGTTTGGACCTGGGAAAGG - Intronic
1187987059 X:24825412-24825434 GCTGGGTGCTGAGCTGGAAAGGG + Intronic
1195080769 X:101367806-101367828 GCTAGGTTTTAGTCTGGAAATGG - Intronic
1200684206 Y:6245336-6245358 ACTAGGTTTTCAGCAGGGAGAGG - Intergenic
1201048427 Y:9909050-9909072 ACTAGGTTTTCAGCAGGGAGAGG + Intergenic
1201158530 Y:11152557-11152579 GTTGGGTTTGGAGCTGGGGAGGG + Intergenic