ID: 1128597747

View in Genome Browser
Species Human (GRCh38)
Location 15:68966854-68966876
Sequence ACTTTAGGTGGATCTCTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 90}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128597740_1128597747 12 Left 1128597740 15:68966819-68966841 CCACCCTTTTACTTTGAGCCTGT 0: 9
1: 15
2: 245
3: 3951
4: 6174
Right 1128597747 15:68966854-68966876 ACTTTAGGTGGATCTCTTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 90
1128597744_1128597747 -6 Left 1128597744 15:68966837-68966859 CCTGTGGATGTCATTACACTTTA 0: 1
1: 1
2: 3
3: 23
4: 209
Right 1128597747 15:68966854-68966876 ACTTTAGGTGGATCTCTTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 90
1128597743_1128597747 8 Left 1128597743 15:68966823-68966845 CCTTTTACTTTGAGCCTGTGGAT 0: 14
1: 81
2: 306
3: 1185
4: 8128
Right 1128597747 15:68966854-68966876 ACTTTAGGTGGATCTCTTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 90
1128597739_1128597747 29 Left 1128597739 15:68966802-68966824 CCATGATATGTCTTCTTCCACCC 0: 1
1: 0
2: 2
3: 18
4: 228
Right 1128597747 15:68966854-68966876 ACTTTAGGTGGATCTCTTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 90
1128597742_1128597747 9 Left 1128597742 15:68966822-68966844 CCCTTTTACTTTGAGCCTGTGGA 0: 2
1: 8
2: 17
3: 42
4: 285
Right 1128597747 15:68966854-68966876 ACTTTAGGTGGATCTCTTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128597747 Original CRISPR ACTTTAGGTGGATCTCTTGC AGG Intronic
902722498 1:18313245-18313267 ACCTCAGGTGGATCCCTTCCAGG + Intronic
909727519 1:78853312-78853334 ACTTTAGGTGGGGATCTTGGGGG + Intergenic
909845726 1:80392134-80392156 TGTTTAGGTGTATCTCTTGTAGG + Intergenic
909989302 1:82202801-82202823 ACTTGAGGAGGAACTCTTGCAGG - Intergenic
911678714 1:100689939-100689961 ACATTAGGTGGGTCTCCTGAAGG + Intergenic
917584153 1:176408377-176408399 ATTTTAGGTGGCTCTTTTCCTGG + Intergenic
919811492 1:201411618-201411640 ATTTAAGGTGTATCTCTGGCTGG - Intronic
919872611 1:201834016-201834038 ACTTTAGGAGGATCACTTGAGGG - Intronic
921125118 1:212170697-212170719 AGTTTAGGTGAAGCTCTTTCTGG - Intergenic
1064318798 10:14282276-14282298 CCTTTAGGAGGGTCACTTGCTGG - Intronic
1066258246 10:33703045-33703067 TCTTAAGGTGTATCTCTAGCCGG - Intergenic
1068830577 10:61490352-61490374 ACTTTTGGTGGGTATTTTGCTGG + Intergenic
1074657162 10:115603924-115603946 ATTCTAGGTGGACCTCTTGGAGG + Intronic
1074720993 10:116265113-116265135 AGTTTAGGTGCATCTCATCCTGG + Intronic
1085917352 11:80905248-80905270 CCTTTAGGTGAATCTCTTGAAGG - Intergenic
1087181174 11:95144029-95144051 TCTCCAGGTGCATCTCTTGCTGG + Intergenic
1092981050 12:13794591-13794613 ACTGTAGAGGGATTTCTTGCTGG - Intronic
1102376124 12:112422564-112422586 GCTTTTGGTTTATCTCTTGCAGG + Intronic
1102530709 12:113544464-113544486 ACTTCAGTTGGATCTGCTGCTGG + Intergenic
1103044488 12:117724507-117724529 ACTTTAGGTGGCTTTGCTGCTGG + Intronic
1104286876 12:127431789-127431811 AGTTTGGGTGGGACTCTTGCAGG - Intergenic
1106605850 13:31228108-31228130 CCTTCAGGTGCATCTCTAGCAGG + Intronic
1107392553 13:39982401-39982423 ACTTCAGGTAGATATCTTGAAGG + Intergenic
1109632657 13:65072175-65072197 AGTTTATGTAGATCTCTTTCTGG - Intergenic
1109697115 13:65975673-65975695 ACTACAGGTGGATCTCAAGCTGG + Intergenic
1115802542 14:37011252-37011274 CCTTTGGGAGGATCTCTTGAGGG - Intronic
1119175225 14:72563624-72563646 AATACAGGTGGATCTTTTGCAGG - Intronic
1120246627 14:82013894-82013916 CCCTTAGGTGGGTCTCTTGTAGG - Intergenic
1126648933 15:50902301-50902323 GCTTTAAGTGGATGTTTTGCTGG + Intergenic
1128597747 15:68966854-68966876 ACTTTAGGTGGATCTCTTGCAGG + Intronic
1131709426 15:95037321-95037343 ACTTTGGGTGGAGGTCTGGCAGG - Intergenic
1131775808 15:95797235-95797257 ACTCCAGGTGAATCTCTTTCAGG + Intergenic
1140962231 16:79927331-79927353 ACTTTGGCTGGATATTTTGCTGG - Intergenic
1145824456 17:27866471-27866493 CCTTTAAGAGGCTCTCTTGCTGG + Intronic
1149111039 17:53031105-53031127 ACTTTTTGTGTATCTCTTGTAGG + Intergenic
1149152631 17:53587058-53587080 ACATTAGGTGTTTCTCTTGTAGG - Intergenic
1149571032 17:57672508-57672530 TCTCTAGGTGGCTCTCCTGCTGG + Intronic
1151046669 17:70928553-70928575 ACTTTAGGTTTATTTCTTTCTGG + Intergenic
1153722440 18:7920087-7920109 AGTTGAGGTGGATTTCTTGTAGG + Intronic
1156310827 18:35920094-35920116 ACATTATGTGGATCTATTTCTGG - Intergenic
1158649760 18:59274214-59274236 ACTCCAGGTGGGTCTCCTGCGGG - Intergenic
1161864942 19:6826815-6826837 TCCTTTGGTGGATCTCTGGCTGG - Intronic
1164447567 19:28330996-28331018 ACTTTGGGTGAATCACTTCCTGG + Intergenic
925236882 2:2286728-2286750 GCTTTAGGTAGATGTGTTGCTGG - Intronic
926165301 2:10519143-10519165 TCTTTGGCTGGATCTCTAGCTGG + Intergenic
926656784 2:15416384-15416406 GCTTTAGGTGTATCTTTTGGGGG - Intronic
927911980 2:26906105-26906127 ACTTGAGGTGAGTCTGTTGCTGG - Intronic
928247269 2:29641411-29641433 ACTTGCGGTGGTTCACTTGCAGG - Intronic
930424113 2:51192156-51192178 ACTTGAGATGGGTCTCTTGAAGG + Intergenic
933524568 2:83418994-83419016 CCATTAGGTGGATCTCTTTTAGG - Intergenic
943955424 2:194182833-194182855 CCTTTAGGTGAATCACTTACAGG + Intergenic
1171006200 20:21467772-21467794 ACTTTAGGAGGTTCTGCTGCTGG + Intergenic
1172853895 20:37986402-37986424 ATTTTATGTGGATATCTTGCAGG - Intronic
1174943508 20:54958513-54958535 ACTTTGGGTGGATCACTTTGAGG - Intergenic
1183370824 22:37431258-37431280 ACGTTAGGAGGTTCTCTTCCGGG + Intergenic
949501897 3:4688126-4688148 CCTTTGGGTGGATCACTTGAGGG - Intronic
949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG + Exonic
954672152 3:52296997-52297019 ACATTAGGGGGCTCTCTTCCAGG - Intergenic
960818149 3:121695373-121695395 TCTTTAGCTGTATCTCCTGCAGG + Exonic
963576875 3:147071551-147071573 ATGTTAGGTGGGTCTCTTGTAGG - Intergenic
964770413 3:160219054-160219076 ACTTTGGGAGGCTCTCTTGAAGG - Intergenic
965892152 3:173527823-173527845 GCATTAGGTGAATCTCTTGAAGG + Intronic
971439335 4:26663067-26663089 ACTTTTGGTGTTTTTCTTGCAGG - Intronic
973929351 4:55774439-55774461 AGTTTAGGTGGGTCTTTTGCAGG - Intergenic
974343332 4:60642450-60642472 ACTTTAGAGGGTTTTCTTGCAGG - Intergenic
976045143 4:80937623-80937645 ACCTAAAGTGAATCTCTTGCAGG + Intronic
978454278 4:108870575-108870597 ATTTTGGGTGGATCTCTTAATGG + Intronic
978926718 4:114254347-114254369 ATGTTAGGTGGGTCTCTTGAAGG - Intergenic
981564776 4:146088395-146088417 ACTTTAGGGAGATTTCTTACTGG + Intergenic
985178354 4:187227632-187227654 AGTTTGGGGGGATTTCTTGCTGG + Intergenic
986378309 5:7156883-7156905 CCTTTAGGTGAGTTTCTTGCAGG + Intergenic
994776847 5:104045904-104045926 AGTTTGGTTGGATCTATTGCTGG - Intergenic
1001182253 5:169531305-169531327 ACCTAAGGGGGATCTCTTGGGGG + Intergenic
1004574415 6:16880717-16880739 ATTTAAGGTGGATTTCTTGCAGG + Intergenic
1015222344 6:130818522-130818544 ATCTTAGGTGAATCTCTTGAAGG - Intergenic
1016226765 6:141747973-141747995 ATGTTAGGTGGTTCTTTTGCTGG - Intergenic
1017386731 6:153894075-153894097 ACTTTAGATGAATTTCTTCCAGG + Intergenic
1019108407 6:169689749-169689771 CCTTCAGGTGCATCTATTGCCGG - Intronic
1024559918 7:50634633-50634655 CCGTTAGGTGGGTCTCTTGTAGG - Intronic
1026514242 7:71053838-71053860 ACTTTAGTTTGATATGTTGCGGG - Intergenic
1050239336 9:3618225-3618247 ATGTTAGATGGATCTCTTGAAGG + Intergenic
1053584253 9:39439767-39439789 AATTTAGGTGTTACTCTTGCTGG - Intergenic
1054105833 9:60998513-60998535 AATTTAGGTGTTACTCTTGCTGG - Intergenic
1055938189 9:81622906-81622928 ACTTTAGGTGGAAAGCCTGCCGG - Intronic
1057074129 9:92126460-92126482 ACTTTAGGTTTTTCTCTTGCTGG + Intergenic
1057085155 9:92203175-92203197 ACTTTAGGTTTTTCTCTTGCTGG - Intergenic
1057798163 9:98172739-98172761 AATTTAGGTGGAGCTCCTGGAGG - Exonic
1058162492 9:101584881-101584903 ACTTTATCTGCATTTCTTGCTGG - Intronic
1187621282 X:21058750-21058772 ATTTTAAGTGGATATCTTGTAGG + Intergenic
1188216208 X:27480520-27480542 GCTTCAGGTGGGTCTCTTGGCGG + Intergenic
1191611325 X:63116944-63116966 CCATTAGGTGGGTCTCTTGTAGG - Intergenic
1192188657 X:68977055-68977077 ACTGTCGGTGGATGTCTTGTGGG - Intergenic
1193873951 X:86837123-86837145 ACTTTAGGTTTATTTCTTTCTGG - Intergenic
1194220814 X:91188270-91188292 AGTTTATGTGGGTTTCTTGCAGG - Intergenic
1196040131 X:111193701-111193723 ACTTTAGGTTACTCTGTTGCAGG - Intronic
1198543050 X:137661011-137661033 ACTTTATCGGGATCTCTGGCAGG + Intergenic
1199259060 X:145749433-145749455 ACTGTAGGTGTATTTCTTCCTGG - Intergenic
1199799544 X:151235948-151235970 ACTTTACAAGGAACTCTTGCTGG + Intergenic
1200557320 Y:4652011-4652033 AGTTTATGTGGGTTTCTTGCAGG - Intergenic