ID: 1128599892

View in Genome Browser
Species Human (GRCh38)
Location 15:68987410-68987432
Sequence GGAGAGGAAGCCTCCACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128599892_1128599900 5 Left 1128599892 15:68987410-68987432 CCCACTGTGGAGGCTTCCTCTCC 0: 1
1: 0
2: 1
3: 13
4: 192
Right 1128599900 15:68987438-68987460 CTCAGGGCCGCACCTTCTCTAGG 0: 1
1: 0
2: 4
3: 20
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128599892 Original CRISPR GGAGAGGAAGCCTCCACAGT GGG (reversed) Intronic
901960544 1:12823157-12823179 GGTGAGGAAGCCTGCATAGTGGG - Intergenic
902089318 1:13890781-13890803 GAGGAGGAAGCCTCCATAGCTGG + Intergenic
903122421 1:21225066-21225088 GGTGGGGGAGCCTCCACGGTCGG + Intronic
903190935 1:21655671-21655693 TGAGAGGAAGCCTCCCCTTTGGG + Intronic
903534813 1:24059943-24059965 GGAGGGGAAGGCCCCACAGATGG + Intronic
903814358 1:26053904-26053926 GAAGAGGAAGAGTCCACAGAAGG - Exonic
904331656 1:29761665-29761687 GGAGCAGAAACATCCACAGTGGG - Intergenic
904744243 1:32701695-32701717 GGAGAGGAAGCCAGCTTAGTTGG + Intronic
907489396 1:54799475-54799497 GGAGAAGAAGGCCCCACTGTGGG + Intronic
908691763 1:66788173-66788195 TGAGAGTAAGCATCTACAGTGGG - Intergenic
909401213 1:75233073-75233095 TGAAAGGAAGCTTCCACAGGTGG + Intronic
915245083 1:154551009-154551031 GGAGAGGAAGCCACCAGATCAGG + Intronic
919004486 1:191878520-191878542 GGAGGGGAGGCCTCCCCAGGAGG - Intergenic
920003015 1:202812173-202812195 GTTGAGGGAGCCTCCACAATGGG + Intergenic
1064591096 10:16891462-16891484 GGTGAGGAAGCCTGCAGAGGGGG + Intronic
1066703316 10:38152484-38152506 GAGGAAGAAGCTTCCACAGTAGG - Intergenic
1066987467 10:42480732-42480754 GAGGAAGAAGCTTCCACAGTAGG + Intergenic
1068682211 10:59832389-59832411 AGAAATGAAGTCTCCACAGTGGG + Intronic
1069193635 10:65521038-65521060 GGAGAGGAACACTGCAAAGTAGG + Intergenic
1069608731 10:69757968-69757990 GGAGAGGACACATCCACAGCGGG + Intergenic
1074365202 10:112852433-112852455 GGAGAGGAAATCTCCAAAGAAGG - Intergenic
1074913634 10:117935481-117935503 GGAGAGGAGGGGCCCACAGTAGG - Intergenic
1076524751 10:131105309-131105331 GGAGAGGGGGACTTCACAGTGGG - Intronic
1077011785 11:381953-381975 GGAGAGGCAGCCTTCACGGCGGG + Exonic
1077893394 11:6436143-6436165 GGAGAGCAAATCTCCACAGCAGG - Intronic
1080553096 11:33390949-33390971 GGAAGGGAAGCTTCCACAGTAGG + Intergenic
1081543284 11:44051540-44051562 GCACAGGGAGCCTCCTCAGTTGG - Intronic
1082243396 11:49893004-49893026 GGCCAGGAAGCCTTCTCAGTAGG - Intergenic
1082264098 11:50101105-50101127 GTAGTGGAATCCTCCACAGGTGG + Intergenic
1083949803 11:65947660-65947682 GGAGAGGAAGCCTCCGATGAGGG + Exonic
1085120711 11:73965646-73965668 GGAGTGGAAGGATCCCCAGTGGG + Intronic
1089624085 11:119740371-119740393 GGTGAAGAAGCCTCCAGATTGGG - Intergenic
1090150282 11:124376820-124376842 GGAGAGGAAGACTCAGCAATTGG + Intergenic
1090385734 11:126356582-126356604 GCAGAGGAAGCAGCCACAGTAGG - Intronic
1091785794 12:3242696-3242718 GGAGGGGCAGCTGCCACAGTGGG + Intronic
1092130936 12:6112752-6112774 GGAGAGGAAGAGTCCCCAGCAGG + Intronic
1093266504 12:17009811-17009833 GGAAAGTCAGCCACCACAGTGGG - Intergenic
1093747442 12:22759454-22759476 GGAGAGGATGTCACCACATTGGG - Intergenic
1095946811 12:47758484-47758506 GGAGAGGAAGCTGACACGGTGGG - Intronic
1096078666 12:48819636-48819658 GCAGAGGAAGCCTCAGCAGGGGG - Intronic
1098460005 12:70722095-70722117 GGAAAGGAAGCGTCCACGGGGGG - Intronic
1100384758 12:94095558-94095580 GGAGAGGAGCCCTGGACAGTGGG - Intergenic
1100836595 12:98572520-98572542 GGGGAGAAATCCTCCACATTTGG - Intergenic
1101879809 12:108618521-108618543 GGAGCTGAAGGCTCCACAGCAGG - Intergenic
1102088082 12:110160434-110160456 GGAGAGGAAGCATCCAACATGGG + Intronic
1104585328 12:130044145-130044167 GCAGAGGATGCCTCCCCAGATGG + Intergenic
1106032807 13:26017971-26017993 AGAGAGGAATCTTCCACAGGGGG - Intronic
1106506754 13:30377134-30377156 GGAGAGGGAGGCTACAGAGTGGG - Intergenic
1107115331 13:36740477-36740499 GGGGAGGAGGGCTGCACAGTTGG - Intergenic
1109881018 13:68476565-68476587 GCAGAGGAACCCTCCACAAGAGG + Intergenic
1113499283 13:110760508-110760530 GGAGAGGCAGCCTGGACCGTCGG + Intergenic
1116431731 14:44854048-44854070 GCAGAAGCAGCCTCCAGAGTGGG + Intergenic
1118387869 14:65271698-65271720 GACCAGGAAGCCACCACAGTAGG + Intergenic
1118675647 14:68181748-68181770 GGAGAGGGTGCCTCCAAAGGTGG + Intronic
1121266361 14:92604866-92604888 TGACAGGAAGCCTCAACAGAAGG - Intronic
1124866906 15:33501100-33501122 GGAGAGGAAGCCTCTCAAATGGG - Intronic
1125836117 15:42753126-42753148 GGAGAGTAAAGTTCCACAGTGGG + Exonic
1126166397 15:45657716-45657738 GAAGAGGAAGCCTGCACAAGGGG - Intronic
1127768344 15:62209680-62209702 AGAGAAGAAGCCACAACAGTAGG + Intergenic
1128232326 15:66044103-66044125 GGAGAGGAAACCTCGACCCTTGG + Intronic
1128599892 15:68987410-68987432 GGAGAGGAAGCCTCCACAGTGGG - Intronic
1128957333 15:71962151-71962173 GGAGAGTAAGCTTCCACTCTGGG + Intronic
1131817271 15:96234530-96234552 GCAGAGGAAGCCACCACTCTTGG - Intergenic
1132721422 16:1318144-1318166 AGAGTGAAAGCCTCCCCAGTGGG + Intronic
1132737101 16:1392289-1392311 GGAGAGGACACCTTCACAGAGGG - Intronic
1135058595 16:19251652-19251674 GGGGAGGAAGCCACCAGGGTGGG + Intronic
1136066442 16:27762011-27762033 GCTCAGGAAGCCTCCACAGGCGG + Intronic
1137291834 16:47056747-47056769 GGAAAGGAAGCATCTGCAGTGGG + Intergenic
1137584012 16:49653166-49653188 GCAGGGGACGCCTCCAGAGTGGG - Intronic
1137968666 16:52961916-52961938 GGAGAGGAAGCAGCCACTGTTGG - Intergenic
1139651755 16:68365732-68365754 GAAGAGGATGCTGCCACAGTGGG - Intronic
1142261384 16:89044062-89044084 GGAGAGTAAGCGTCCACTGGGGG - Intergenic
1142624177 17:1181378-1181400 GGTGGGGAAGCCTCTACAGGTGG + Intronic
1143353308 17:6305888-6305910 GGAGAGGTGGGCTCCCCAGTGGG - Intergenic
1145235965 17:21208657-21208679 TGAGTGGAAGCATCCACATTAGG + Intronic
1145765710 17:27456976-27456998 GGAGGGGAAGCCTCCAAGGGGGG - Intronic
1146284414 17:31564920-31564942 AGGGAGGAAGTATCCACAGTGGG - Intergenic
1148222359 17:45871998-45872020 GGAGGGGAGGCCTCCATAGAAGG + Intergenic
1148454400 17:47803273-47803295 GGAGAGCATGGCTCCACGGTTGG - Intergenic
1148723073 17:49768755-49768777 GGAGAGGGAGGCACCAGAGTGGG - Intronic
1149112054 17:53046114-53046136 GGAGTAGAGGCCTCCACAGTGGG + Intergenic
1152564306 17:81093290-81093312 GCTGAGGAAGCCTCCAGAGCTGG - Intronic
1155239084 18:23848159-23848181 GGAGCTGAGGCCTCCACAGCAGG + Intronic
1157068948 18:44383631-44383653 TGGGAGGAAACCTCCACAGCAGG + Intergenic
1158608501 18:58917460-58917482 GGAGATAAAGCCTCCACTGCAGG - Intronic
1159208567 18:65285828-65285850 GGAGAGGAAGCATCCACCACTGG - Intergenic
1160388294 18:78511619-78511641 GGACAGGAAGCCTCTCCAGCAGG + Intergenic
1160402106 18:78618781-78618803 CGAGAGGAGGCCACCACAGTGGG - Intergenic
1162439884 19:10686404-10686426 ACACAGGGAGCCTCCACAGTGGG - Intronic
1163388508 19:17015281-17015303 GAAGAGGAACACCCCACAGTTGG - Intronic
1163654473 19:18537837-18537859 AGAGAGGCAGCCTCCGCAGAGGG - Intronic
1165149067 19:33750432-33750454 GGAGGAGAAGCCACCAGAGTTGG + Intronic
1165389188 19:35528577-35528599 AGAGAGGAGGCCTGGACAGTGGG - Intergenic
1165586697 19:36922877-36922899 GGAGAGAAAGGCTCTACATTTGG + Intronic
1167641675 19:50686063-50686085 GGAAAGGAGGTCTCCAAAGTTGG + Intronic
926239561 2:11074596-11074618 GGAGACGGAGCCTGCACAGATGG - Intergenic
928215012 2:29354199-29354221 GGACAGGAAACAGCCACAGTTGG - Intronic
929235261 2:39598336-39598358 GCTGGGGAAGCCTGCACAGTGGG - Intergenic
933648378 2:84830297-84830319 GGAGAGGAGGGCTCCTCAGAAGG + Intronic
933855911 2:86413878-86413900 TGAGAGGAGGTCTCCACAGCCGG + Intergenic
934712121 2:96523090-96523112 GGGGAGGAAGCAGCCACAGATGG - Intergenic
936451230 2:112635382-112635404 GGAGAGGGAGGTTCCCCAGTGGG + Intergenic
941012532 2:160317497-160317519 GAAGAGGAGGCGTCTACAGTAGG - Intronic
941959579 2:171240306-171240328 GGAGAGGTAGCCTCCCCAGGAGG + Intergenic
942744894 2:179220742-179220764 GGAGAGGAAACACCTACAGTAGG - Intronic
944183941 2:196926996-196927018 AGAGAGGAAGCATCCAGAGGGGG + Intronic
944386399 2:199169739-199169761 GGAGGGGTAGCCTCCACTGCCGG + Intergenic
945780104 2:214159548-214159570 GGAGATAGAGCCTGCACAGTTGG + Intronic
945956976 2:216095410-216095432 GGTGAGGAAGCCTTACCAGTAGG - Intronic
948055714 2:235008088-235008110 GGAGAGGAAGGCCACACAGAGGG - Intronic
1170238096 20:14130704-14130726 GGAAAAGAAGGCTTCACAGTCGG + Intronic
1172685211 20:36748649-36748671 GGAGGTGAAGCCTGAACAGTGGG - Intergenic
1173224590 20:41154803-41154825 GGAGAGTAAGCCCCCACCCTGGG - Intronic
1175537071 20:59722279-59722301 GTACAGGAAGCCACTACAGTGGG + Intronic
1175578589 20:60081054-60081076 GGTGATGCAGCCTCCAAAGTAGG + Intergenic
1177139353 21:17341814-17341836 TGAGAGGAAGTCTTCCCAGTGGG - Intergenic
1179150290 21:38804002-38804024 GCAGAGGAAGGTTCCACTGTCGG + Intergenic
1180011020 21:45051623-45051645 TGAGATGAAGCCCCCACGGTAGG + Intergenic
1180029111 21:45190871-45190893 TGGGAGGAAGCCTCCATACTGGG - Intronic
1180045454 21:45303066-45303088 GGAGAGGAGGCATTCACTGTGGG - Intergenic
1181498377 22:23301369-23301391 AGAGAGGGAGTCACCACAGTTGG - Intronic
1181894313 22:26093505-26093527 CGAGAGGAAGCCAGCACAGAGGG + Intergenic
1183581587 22:38729600-38729622 GGAGATGAAGCCTCCTCTGTAGG + Exonic
1183988859 22:41584677-41584699 AGAGAGGAAGCCTACACCCTTGG + Intronic
949477825 3:4465891-4465913 TGAGAGGTAACATCCACAGTAGG - Intronic
949977090 3:9470755-9470777 GGATAGGAAGCCTTTACATTTGG + Exonic
950228814 3:11258319-11258341 GGAGAAGAAGATTCCAGAGTTGG + Intronic
950988281 3:17400798-17400820 GGGCAGGAAGCATCCACCGTGGG - Intronic
951915787 3:27799461-27799483 TGAAGGGCAGCCTCCACAGTAGG - Intergenic
953182826 3:40612634-40612656 GGTCAGGAAGCCTTCCCAGTTGG - Intergenic
954881291 3:53837623-53837645 GCTGAGGAAGCACCCACAGTGGG - Intronic
957583288 3:82104301-82104323 GGAGAGGAACAATACACAGTAGG - Intergenic
958499712 3:94889487-94889509 GGGCAGGAAGCATCCAAAGTGGG - Intergenic
966911624 3:184562936-184562958 GGAGAGGGAGCCTCCACAAAGGG - Intronic
969635861 4:8369275-8369297 GGAGAGGCAGTCTCCCCAGGAGG - Intronic
972025712 4:34374444-34374466 GGAGGGGGAGCCTCCCGAGTTGG - Intergenic
972322663 4:37986809-37986831 GGAGAGGAAGCCTGAGTAGTCGG + Intronic
973704010 4:53564012-53564034 GGAGAGGATGCCCCCACATCAGG - Intronic
973977823 4:56280762-56280784 GAAAAGGAAGAATCCACAGTTGG + Intronic
975966832 4:79983915-79983937 TAATAGGAAGCATCCACAGTTGG + Exonic
977590518 4:98821099-98821121 GGAGGGGAAGGCACCAAAGTGGG + Intergenic
980322578 4:131298017-131298039 GGGCAGGAAGCATCCAGAGTGGG - Intergenic
984478028 4:180261569-180261591 GGAGATCAAACCTCCACAGCAGG + Intergenic
984743967 4:183195729-183195751 GAAGAGGAGGCAACCACAGTTGG - Intronic
985042936 4:185910426-185910448 GGGGAGAAAGTCTCCAGAGTTGG - Intronic
986671975 5:10150660-10150682 GGAGAGGAGGGCTCAACAATCGG + Intergenic
991116437 5:62961101-62961123 GGACAGGAAGCATCCAGAATGGG + Intergenic
991410995 5:66345681-66345703 GGAAAGGAAGGCTACACAGTTGG - Intergenic
991945518 5:71895079-71895101 ATAGAGGAAACCTCCTCAGTAGG - Intergenic
996806597 5:127462417-127462439 GGAGAGGCAGTTTCCACATTGGG + Intronic
997307914 5:132853404-132853426 ATAGAGGAAGCCTCCATAGCTGG + Intergenic
997631565 5:135372845-135372867 GGAGGGGAAGCCAGCAAAGTGGG - Intronic
997710382 5:135999181-135999203 GGAGATGATGCCTGCACAGCAGG + Intergenic
998266183 5:140669413-140669435 GGCCAGGAAGCGGCCACAGTGGG - Exonic
998509289 5:142697949-142697971 GGAGAGGAAGGCTGCCGAGTGGG + Exonic
999194891 5:149775113-149775135 TGGCAGGAGGCCTCCACAGTAGG - Intronic
1001788395 5:174433531-174433553 GGAGAGGAATCCTCCACTGTCGG + Intergenic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1007622990 6:43226157-43226179 TGAGAGGAAGCCTCAGCATTGGG + Intronic
1008865481 6:56204636-56204658 GGACAGACTGCCTCCACAGTGGG + Intronic
1011028786 6:82898646-82898668 GGAGAGGAAGACCACACACTGGG + Intronic
1016000912 6:139040319-139040341 GGAGAGGCAGCAGCCACAGAAGG + Intronic
1017652574 6:156596869-156596891 GTAGAGAATGCCTTCACAGTTGG - Intergenic
1017907986 6:158769882-158769904 GGAGAGGAAGCGGGCACAGGAGG - Exonic
1018568336 6:165181792-165181814 GGAGAAGAAGCTGCCAGAGTGGG - Intergenic
1018840164 6:167510732-167510754 GCAGAGGCATCCTCCACAGGAGG + Intergenic
1018987588 6:168649409-168649431 GGAGAGGCAGCCTCCCCAGCAGG + Intronic
1020031265 7:4934471-4934493 AGAGAGGCAGCCTCGACGGTGGG + Intronic
1023054869 7:36283362-36283384 GGAGGGGAAGCCTCTGCGGTGGG - Intronic
1023359010 7:39396846-39396868 GGAGATGTAGCCTCCATAGCCGG + Intronic
1026231806 7:68490300-68490322 ACAGAGGAAGCCTACACAGCTGG + Intergenic
1026261675 7:68760923-68760945 GGGCAGGAAGCATCCACCGTGGG + Intergenic
1028408536 7:90502708-90502730 GAGGAGTAAGCCTCAACAGTGGG + Intronic
1029601016 7:101563531-101563553 GGGGAGCCAGCCTCCACAGCTGG - Intergenic
1030315874 7:108113987-108114009 ACAAAAGAAGCCTCCACAGTTGG + Intronic
1031657834 7:124380156-124380178 TGGGTGGAAGCCACCACAGTTGG - Intergenic
1033348871 7:140545824-140545846 GGAGAGGAAGCCTCACCGTTGGG - Intronic
1033853400 7:145525953-145525975 TAAAAGGAAGCCCCCACAGTAGG + Intergenic
1034784476 7:153912997-153913019 GGAGAAGAAACCTCCATCGTTGG - Intronic
1035168863 7:157006908-157006930 GGAGAGGAAGCCTCCTGCGATGG - Intronic
1035280392 7:157774835-157774857 CTAGAGGAAGCCTCCCCCGTCGG - Intronic
1037417745 8:18669557-18669579 GGGCAGGGAGCATCCACAGTGGG + Intronic
1041398138 8:57412907-57412929 GAAGAGGAAATCTACACAGTTGG - Intergenic
1041944380 8:63424842-63424864 GGACAGGCTGCCTCCTCAGTTGG + Intergenic
1046436557 8:114196895-114196917 GGAGAAGAAGGCTCTACAGTAGG - Intergenic
1047431870 8:124799829-124799851 GGAGAGGAAGCAACCAGAATTGG - Intergenic
1049181567 8:141225764-141225786 GGAGAAGCAGCCTCCACAGGAGG - Intronic
1049325280 8:142018277-142018299 GGAGAGTGAGCCCCAACAGTAGG - Intergenic
1049450986 8:142661370-142661392 GGACAGGCAGCCTCCACTCTGGG - Intronic
1050740536 9:8814401-8814423 GGAGGGGAAGACCCCACAGAAGG + Intronic
1054883449 9:70170347-70170369 GGAGAGGCAGCCCCCACTGGTGG - Intronic
1056551745 9:87658496-87658518 GGGGAGGAAGAATCCTCAGTGGG + Intronic
1056649853 9:88449310-88449332 GGAGAGGAAGCCTGCACGCAAGG - Intronic
1056802872 9:89705818-89705840 GCAGATGAAACCTCCAGAGTAGG + Intergenic
1057079001 9:92158400-92158422 GGAGAGGGGGACTTCACAGTGGG - Intergenic
1057164927 9:92917821-92917843 AGAGAGGGAGCCTCCAGAGGTGG - Intergenic
1059679347 9:116571174-116571196 GGAGAGGAAACCACCAGCGTGGG - Intronic
1062004003 9:134230315-134230337 GGACAGGAAGGCTCCCCAGAGGG - Intergenic
1187413399 X:19070601-19070623 GTAGAGGGAGCCTGCCCAGTTGG - Intronic
1187778295 X:22788525-22788547 TGAGAGGAAGTCTTCTCAGTGGG + Intergenic
1189803223 X:44710948-44710970 GGAGATTAAGTTTCCACAGTGGG - Intergenic
1190719363 X:53134445-53134467 GGAGATGAGGGATCCACAGTTGG + Intergenic
1195923524 X:110003854-110003876 AGAGAGGAAGGCAGCACAGTCGG - Exonic
1198060533 X:133041870-133041892 GGAAAGGAAGCAGCCCCAGTCGG - Intronic
1198322967 X:135537524-135537546 GGTGAGGAAACAGCCACAGTGGG + Intronic
1199610222 X:149606498-149606520 AGAGAGGGAGCCTCTACAGAGGG - Intronic
1200093089 X:153644781-153644803 GGAGAGGCAACCTCCGCAATGGG - Intronic