ID: 1128600652

View in Genome Browser
Species Human (GRCh38)
Location 15:68992877-68992899
Sequence GCTTTCGGAGTGACCAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 4, 2: 20, 3: 29, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128600650_1128600652 -5 Left 1128600650 15:68992859-68992881 CCGTGTGTAGACTGGTCAGCTTT 0: 1
1: 5
2: 10
3: 31
4: 166
Right 1128600652 15:68992877-68992899 GCTTTCGGAGTGACCAGAGCAGG 0: 1
1: 4
2: 20
3: 29
4: 104
1128600649_1128600652 -2 Left 1128600649 15:68992856-68992878 CCGCCGTGTGTAGACTGGTCAGC 0: 2
1: 1
2: 0
3: 2
4: 35
Right 1128600652 15:68992877-68992899 GCTTTCGGAGTGACCAGAGCAGG 0: 1
1: 4
2: 20
3: 29
4: 104
1128600647_1128600652 8 Left 1128600647 15:68992846-68992868 CCTCAAGTTTCCGCCGTGTGTAG 0: 1
1: 0
2: 5
3: 21
4: 63
Right 1128600652 15:68992877-68992899 GCTTTCGGAGTGACCAGAGCAGG 0: 1
1: 4
2: 20
3: 29
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128600652 Original CRISPR GCTTTCGGAGTGACCAGAGC AGG Intronic
901987766 1:13089755-13089777 GCTTCTGGAGTGACCAGAGCAGG - Intergenic
901994046 1:13137012-13137034 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
902990812 1:20186033-20186055 GCTTCCGGCGTGACCGGAACCGG - Intergenic
905022108 1:34825257-34825279 GCTTTTGGAGGCAGCAGAGCTGG - Intronic
905061419 1:35142874-35142896 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
906032819 1:42734439-42734461 GGATTCGGGGTGAGCAGAGCTGG + Exonic
907271714 1:53295231-53295253 GCTGTGGGAGTGAAGAGAGCAGG + Intronic
920533381 1:206721614-206721636 GCTTTAGGAGCAGCCAGAGCAGG + Intronic
1067133240 10:43585268-43585290 GCTTCCGGAGTGACCACAGCAGG + Intergenic
1070399440 10:76040422-76040444 GCTTTCAGATATACCAGAGCAGG - Intronic
1074445609 10:113518983-113519005 GCTTTCAGTGGGACTAGAGCTGG + Intergenic
1075923351 10:126231621-126231643 TCTTTCCATGTGACCAGAGCAGG - Intronic
1076473462 10:130736232-130736254 GCTTTAGGAGCGACCAAAGGAGG + Intergenic
1077443350 11:2578827-2578849 GCCTTCGGGGTGGCCACAGCGGG + Intronic
1082960992 11:58918766-58918788 GCTTCCAGAGTGACTAGAGCAGG + Intronic
1084390363 11:68871674-68871696 GCCTCCAGAGTGACTAGAGCAGG - Intergenic
1085010506 11:73137784-73137806 ACGTCCCGAGTGACCAGAGCAGG + Intronic
1085454712 11:76659294-76659316 GCATTCCCAGTGCCCAGAGCAGG + Exonic
1085572868 11:77574348-77574370 GCCTCCGGAGTGACCAGAACAGG - Intronic
1089061875 11:115632416-115632438 GATCTGGGAATGACCAGAGCTGG + Intergenic
1089577992 11:119460272-119460294 CCTTCGGGAGTGACCAGACCTGG - Intergenic
1089769138 11:120790167-120790189 GCTTTCAAAGTGTCCAGAGAAGG - Intronic
1090619258 11:128547122-128547144 CCCTTGGGACTGACCAGAGCAGG + Intronic
1090670641 11:128942880-128942902 GCTTTCGGAGTGAGCTGAGCAGG + Exonic
1091324069 11:134671063-134671085 GCCTTTGCAGTGACCTGAGCGGG + Intergenic
1102199279 12:111046272-111046294 GCTTGCGGAGAGACCAGTGCAGG + Intronic
1104952935 12:132450592-132450614 GCTTGCGGGGTGAGCTGAGCCGG + Intergenic
1109394408 13:61736832-61736854 GCTTTCAGTGTAACCATAGCTGG - Intergenic
1112367496 13:98767831-98767853 GCTTCCAGAGTGACCAGAGCAGG - Intergenic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1115522166 14:34243838-34243860 GCTTTCAGAGACACAAGAGCAGG + Intronic
1118951388 14:70439439-70439461 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
1120689658 14:87578413-87578435 GCTTTGGAAGTCACCAGAGTGGG - Intergenic
1123218934 14:106839144-106839166 GCTTCCGAAGTAAGCAGAGCCGG + Intergenic
1128600645 15:68992812-68992834 GCTTCTGGGGTGACTAGAGCAGG + Intronic
1128600652 15:68992877-68992899 GCTTTCGGAGTGACCAGAGCAGG + Intronic
1128976239 15:72155876-72155898 GCCTTCCGAGTGGCCAGAGCTGG + Intergenic
1130275864 15:82476082-82476104 GCTTTCTGACTGCCCAGAGAGGG + Intergenic
1130468223 15:84203474-84203496 GCTTTCTGACTGCCCAGAGAGGG + Intergenic
1130496041 15:84470068-84470090 GCTTTCTGACTGCCCAGAGAGGG - Intergenic
1130590516 15:85208072-85208094 GCTTTCTGACTGCCCAGAGAGGG + Intergenic
1132845175 16:1997911-1997933 GCTTTGGGAGGGCCCAGATCAGG + Exonic
1133069615 16:3236068-3236090 CCTATGGGAGTCACCAGAGCGGG - Intronic
1133279066 16:4655031-4655053 GCATTTGGAGTGACCAGGGCAGG + Intronic
1133678270 16:8096368-8096390 GCTTCAGCTGTGACCAGAGCTGG - Intergenic
1136835286 16:33495064-33495086 GCTTGCAGAGGGAACAGAGCTGG + Intergenic
1140557955 16:75943278-75943300 GCTATCAGAGTGATCAGAGCAGG + Intergenic
1141594329 16:85088195-85088217 CCTGTCCGAGTGACAAGAGCAGG + Intronic
1203009517 16_KI270728v1_random:228968-228990 GCTTGCAGAGGGAACAGAGCTGG - Intergenic
1151911957 17:77089241-77089263 GCATTCGAAGTGACCTCAGCAGG + Exonic
1154108581 18:11546929-11546951 GCTTCCAGTGTGACTAGAGCAGG + Intergenic
1154156906 18:11951031-11951053 GCTTTCATAGTTACCTGAGCAGG + Intergenic
1155873593 18:31057165-31057187 GCTTTCCTGGAGACCAGAGCAGG - Intergenic
1157321422 18:46637425-46637447 GATTTTTGAGTGACCAAAGCAGG + Intronic
1160593990 18:79961926-79961948 GCTTTCGGTGTCTCCAGGGCGGG - Intergenic
1160714061 19:567493-567515 GCTTCCGGGGTGACTAGAGCAGG + Intergenic
1163318827 19:16560079-16560101 GCTTTCAGACTGACCACAGGCGG - Intronic
1163863986 19:19757055-19757077 GATTTGGGAGAGACCAGAGGTGG - Intergenic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1164033596 19:21433819-21433841 GCTTCCAGAATGACCAGAGCAGG + Intronic
1164142567 19:22486246-22486268 GCTTCCAGTGTGACTAGAGCGGG + Intronic
1164142573 19:22486311-22486333 GCTTCCGAAGTGACCAGAGCAGG + Intronic
1164148598 19:22529186-22529208 GCCTCCGGAGTGACCAGGGCAGG - Intronic
1164286107 19:23819283-23819305 GCTTCTGAAGTGACCAGAGCAGG + Intronic
1167999802 19:53436020-53436042 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1168004236 19:53473397-53473419 GCCTCCAGAGTGACCAGAGCAGG + Intronic
925164129 2:1705233-1705255 GGTTTGGGAGTGAACTGAGCCGG - Intronic
927170758 2:20367492-20367514 GATTTAGGAGGGACCAGAGGTGG - Intergenic
934656697 2:96120097-96120119 GATTTAGGTTTGACCAGAGCTGG - Intergenic
935757899 2:106291182-106291204 GCTTCCTCAGTGAACAGAGCAGG + Intergenic
940865323 2:158812140-158812162 GCTTTTGGGGTGCCCAGAGCAGG - Intronic
943356850 2:186867088-186867110 GTCCTCTGAGTGACCAGAGCTGG + Intergenic
945116223 2:206410540-206410562 TCTTTCGGAATGACCAGGGTAGG - Intergenic
946819274 2:223613555-223613577 GGTTTCGGAGGAACCAGGGCGGG + Intergenic
948846658 2:240686141-240686163 GCTTTCCTAGTGGCCAGCGCTGG + Intergenic
1170850831 20:20003148-20003170 GCCTTCGGTGGGACGAGAGCGGG + Intergenic
1171951019 20:31422389-31422411 ACTTTCTCAGTGACCAGAGCTGG - Intergenic
1174275546 20:49401134-49401156 GCCTTCGGAGTAGCCACAGCAGG - Intronic
1179086814 21:38225659-38225681 GCTTCCAGGGTGACTAGAGCAGG + Intronic
1179086823 21:38225723-38225745 GCTTCTGGAGTGACCAGAGCAGG + Intronic
1180055470 21:45356814-45356836 GCTTTGGGAGAGACAGGAGCAGG - Intergenic
1184943321 22:47784142-47784164 GCGTGGGGAGTGACCAGGGCCGG - Intergenic
949949603 3:9218209-9218231 GCTCTAGGAGAGACCACAGCTGG + Intronic
950098550 3:10343981-10344003 GCTTTGGGAGAGAACAGAGGTGG - Intronic
950436235 3:12981998-12982020 GGTTTCTGTGTGACCTGAGCTGG + Intronic
953051725 3:39350243-39350265 GCTTCCGGTGTGGTCAGAGCAGG - Intergenic
953957945 3:47245976-47245998 GCTCTGAGAGTGCCCAGAGCAGG - Intronic
955582727 3:60442154-60442176 CCTTTCAGAGTGACCAGGGCTGG - Intronic
957674400 3:83347643-83347665 GATTTCGGAGGGGCCAGAGGTGG + Intergenic
957858515 3:85912004-85912026 GCTTGCAGAGTGAGCAGAGATGG - Intronic
959961921 3:112307054-112307076 GCCTCCGGAGTGGCCACAGCAGG - Intergenic
961715654 3:128855752-128855774 GCTTCTGGAGTCACCAGAGCAGG + Intergenic
962271935 3:133983818-133983840 GCTTTGGGAGAGACGAGGGCTGG + Intronic
967412396 3:189180241-189180263 GATTTGGGAGCGACCAGAGGTGG - Intronic
968380562 4:92423-92445 GATTTGGGAGTGACCAAAGGTGG - Intergenic
968657776 4:1786041-1786063 GCTCTCGGAGTCCCCAGGGCTGG - Intergenic
969647242 4:8438909-8438931 GCCTCCGGAGTGACCAGAGCAGG - Intronic
971396191 4:26229610-26229632 GGTTTCAGTGAGACCAGAGCTGG + Intronic
972480185 4:39489304-39489326 GCTTCTGGAGTGACTAGAGCAGG - Intergenic
974976549 4:68901219-68901241 GCTTCCGGAGTGACCAGAATAGG + Intergenic
977296938 4:95220761-95220783 GCTTTCAGAGGGCCCAGATCTGG + Intronic
978557385 4:109995530-109995552 GTTTTCGGAGTGAGCACAGTGGG - Intronic
978953588 4:114590829-114590851 GCTTCCAGTGTGATCAGAGCAGG + Intergenic
979058031 4:116018946-116018968 GCTTCCAGAGTTACCAGAGCAGG - Intergenic
979058036 4:116019010-116019032 GCTTCCGGGGTGACTAGAGCAGG - Intergenic
988718414 5:33851575-33851597 GCTTTGGCAATGACCAGAGGAGG - Intronic
993253039 5:85552989-85553011 GATTTGGGAGGGACCAGAGGTGG - Intergenic
993890259 5:93464033-93464055 GATTTCGGAGGGGCCAGAGGTGG + Intergenic
997855227 5:137367274-137367296 GCTTACGGAGAGTCCAGACCAGG - Intronic
998375547 5:141688229-141688251 GCTTTGGGAGTGACCAGAGGGGG + Intergenic
998401058 5:141849443-141849465 GCTTTCGGAGAGACCCGAGTTGG - Intergenic
1001298345 5:170515114-170515136 GCTTTGGAAGTGGCCAAAGCTGG - Intronic
1002683113 5:180984594-180984616 CCTTTCGGGGTGAGTAGAGCAGG - Intergenic
1004503311 6:16227755-16227777 GCCTCCGGAGTGAGCAGAGCAGG + Intergenic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1007809553 6:44476291-44476313 GCCTTCGGAGTGAGGAGAGGCGG - Intergenic
1008583346 6:52926068-52926090 GCCTCCAGAGTGACCAGAGCAGG - Intergenic
1011299977 6:85863760-85863782 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
1011378532 6:86718194-86718216 GATTTGGGAGTGACCAGGGGTGG - Intergenic
1016272156 6:142301854-142301876 GCTTCCGGCGTGACTGGAGCTGG - Intronic
1019748527 7:2714159-2714181 CCCTTCGGAGTGACGAGGGCGGG + Exonic
1020878218 7:13725264-13725286 GCTGTCAGAGTGACAAGTGCAGG + Intergenic
1022025316 7:26443050-26443072 GCTTTCAGAGAGACCACAGCGGG + Intergenic
1022282273 7:28923416-28923438 TCTTTCCCATTGACCAGAGCAGG + Intergenic
1025823535 7:64993186-64993208 GCTTCTGGGGTGACTAGAGCAGG + Exonic
1025823542 7:64993250-64993272 GCTTCCGGAGTGACCAGAGCAGG + Exonic
1028400612 7:90421423-90421445 GCTTTGGCAGGGAACAGAGCAGG + Intronic
1031275127 7:119712009-119712031 GATTTGGGAGGGACCAGAGGTGG - Intergenic
1031300241 7:120055522-120055544 GCTTCCAGGGTGACTAGAGCAGG + Intergenic
1032571506 7:133004554-133004576 GCTTTCTGAGAGGCCAGAGCAGG + Intronic
1033109153 7:138559552-138559574 GCTTCTGGGGTGACTAGAGCCGG + Intronic
1033365065 7:140666710-140666732 GCTTCCGGAGTGACCAGAGCAGG - Intronic
1034489818 7:151387240-151387262 GCTTCCTGGGTGACCAGGGCAGG + Intronic
1034489826 7:151387265-151387287 GCTTGCTGGGTGACCAGGGCAGG + Intronic
1039443352 8:37611058-37611080 GCTTTGGAAGTGCTCAGAGCTGG - Intergenic
1041008753 8:53521221-53521243 GCCTCCAGAGTAACCAGAGCAGG + Intergenic
1044304040 8:90617293-90617315 GATTTGGGAGTGGCCAGAGGTGG + Intergenic
1049187313 8:141263943-141263965 CCTTTCAGAGTGGCCAGTGCTGG - Intronic
1051327131 9:15984203-15984225 GCTTTCTCATTGACCACAGCAGG - Intronic
1060823912 9:126676744-126676766 CCTTTCGGAGTTACCAGGGGTGG + Intronic
1061264873 9:129499089-129499111 GGTTCCAGAGTGACCAGGGCTGG - Intergenic
1061794602 9:133078649-133078671 GCCTCACGAGTGACCAGAGCAGG + Intronic
1062065120 9:134522562-134522584 GCTCTCCGAGGGAGCAGAGCCGG - Intergenic
1190457458 X:50639991-50640013 GATTTCAGAGTGCCCAGAGTGGG + Intronic
1191755514 X:64588340-64588362 GCCTTCGGAGAGACCAGTCCTGG - Intergenic
1194090806 X:89580687-89580709 GCTTCTGGGGTGACTAGAGCAGG + Intergenic
1194090813 X:89580751-89580773 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1200443458 Y:3236747-3236769 GCTTCTGGGGTGACTAGAGCAGG + Intergenic
1200443465 Y:3236811-3236833 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1201858325 Y:18569472-18569494 GCTTTTGGAGTGACCAGAGCAGG + Intronic
1201860304 Y:18590490-18590512 GCTTTTGGAGGGACCAGAGCAGG + Intergenic
1201873019 Y:18729891-18729913 GCTTTTGGAGGGACCAGAGCAGG - Intergenic
1201874996 Y:18750909-18750931 GCTTTTGGAGTGACCAGAGCAGG - Intronic
1202168721 Y:22018600-22018622 GCTTTCGGAATGACCAGAGTAGG - Intergenic
1202222640 Y:22567768-22567790 GCTTTCGGAATGACCAGAGTAGG + Intergenic
1202320475 Y:23627892-23627914 GCTTTCGGAATGACCAGAGTAGG - Intergenic
1202550292 Y:26042164-26042186 GCTTTCGGAATGACCAGAGTAGG + Intergenic