ID: 1128602050

View in Genome Browser
Species Human (GRCh38)
Location 15:69003774-69003796
Sequence TTGTCCATCTAGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 1, 2: 17, 3: 50, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128602048_1128602050 8 Left 1128602048 15:69003743-69003765 CCAAACCATGGAAAAAGAGACTT 0: 1
1: 1
2: 7
3: 45
4: 495
Right 1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG 0: 1
1: 1
2: 17
3: 50
4: 222
1128602049_1128602050 3 Left 1128602049 15:69003748-69003770 CCATGGAAAAAGAGACTTAACAA 0: 1
1: 0
2: 8
3: 47
4: 385
Right 1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG 0: 1
1: 1
2: 17
3: 50
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128602050 Original CRISPR TTGTCCATCTAGAAGAGTGA AGG Intronic
905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG + Intronic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
912956299 1:114156001-114156023 TTCTCAATCTAGCAGTGTGAAGG + Intergenic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
916651149 1:166835829-166835851 TTCTCCATCTGCCAGAGTGAAGG - Intergenic
916776040 1:167965495-167965517 TTGTACATCCAGCAGAGGGAGGG - Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918917188 1:190658325-190658347 TTATCCATCTAGAATTGTTATGG + Intergenic
918917190 1:190658357-190658379 TTATCCATCTAGAATTGTTATGG + Intergenic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
922847428 1:228698653-228698675 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
923127589 1:231046074-231046096 TTGTCCTGCTACAAGAGTGGTGG - Intergenic
923657545 1:235931340-235931362 TTGTCCAGGGAGAAGAGCGAAGG - Intergenic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1063949770 10:11211296-11211318 TTGTCCATATATTAGAGTCAAGG + Intronic
1064709770 10:18111435-18111457 TGGTCCAGATAGAAGAGAGAAGG - Intergenic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1066116667 10:32246686-32246708 TTGTCCATTTAAAAGAATTAAGG - Intergenic
1066976426 10:42372236-42372258 ATACCCATCCAGAAGAGTGAAGG + Intergenic
1067360628 10:45574878-45574900 TAGTCCTTTTGGAAGAGTGAGGG - Intronic
1067570037 10:47365010-47365032 TTCCACATCTAGAAGAGGGAAGG - Intergenic
1068035518 10:51755287-51755309 TTGGCCATCTAGAGTACTGATGG + Intronic
1073502435 10:103952675-103952697 TTGTCCATGTCAAAGAATGAAGG + Intergenic
1073515012 10:104068530-104068552 TTGGCCTTCTAGAAGCTTGAGGG - Intronic
1074621463 10:115128311-115128333 TTTTATATCTAGAAGACTGAGGG + Intronic
1075618160 10:123906280-123906302 ATGTCTACCTAGAAGAGAGATGG + Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083343707 11:61975119-61975141 TTTTTCATGCAGAAGAGTGAGGG - Intergenic
1083668430 11:64287578-64287600 TTCTCCATCTGTAAGAGTGGAGG + Intronic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1087951622 11:104227723-104227745 TTATAAATCTAGAAGAGAGATGG - Intergenic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1088767634 11:112999237-112999259 TTTTCCACTTAGAGGAGTGAAGG - Intronic
1089524867 11:119090266-119090288 GTATCCTTTTAGAAGAGTGACGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1093358773 12:18199450-18199472 TAGTCCTTTTACAAGAGTGAGGG - Intronic
1096551111 12:52372247-52372269 TTGTTCACCTAGAAAAGTGCTGG + Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098502563 12:71210505-71210527 GTGTCCTTCTAGAAGAATAAAGG - Intronic
1098711973 12:73774195-73774217 ATGCCCATCCAGAAGAGTGAAGG - Intergenic
1100009694 12:89938439-89938461 TTGTGTATCTAGAAGAGAGAAGG + Intergenic
1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1100566144 12:95796053-95796075 TTGTCCATCTTCAAGAGTGCAGG - Intergenic
1100645313 12:96523087-96523109 ATATCCATCTAGAACAGTCAGGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101859113 12:108468363-108468385 TTTTCCATCAAGAAGAGGAAAGG + Intergenic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1106571092 13:30928727-30928749 TTGTCCAAATGTAAGAGTGAAGG + Intergenic
1106802031 13:33265962-33265984 TTGTCCATCCCGAAAAGTTATGG + Intronic
1106933271 13:34690252-34690274 TTGACCATCTGAAAGACTGATGG + Intergenic
1107255476 13:38421082-38421104 CTACCCATCTAGAAGAGTGAAGG + Intergenic
1107818013 13:44261658-44261680 ATGTCCATCAAGAAGAGGAAGGG + Intergenic
1110232069 13:73177519-73177541 TTGTTTTTCTAGTAGAGTGATGG - Intergenic
1111062369 13:83039030-83039052 TTGTCCATCTAGGAAACAGATGG - Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1111807854 13:93060090-93060112 TTGTTCATCTAATAAAGTGATGG + Intergenic
1113049284 13:106190671-106190693 TTGTCTCTTTAGAACAGTGATGG - Intergenic
1113631691 13:111892492-111892514 TGGTCCATTTTGAGGAGTGAGGG - Intergenic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1115006366 14:28490049-28490071 ATGTCCATCCAAAAGAATGATGG + Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1117763335 14:59056062-59056084 TGGTCCATCTCCAAGAGTGCTGG - Intergenic
1118464837 14:66021628-66021650 TGGAACATCTTGAAGAGTGAGGG - Intergenic
1120270498 14:82308079-82308101 TTGTGTATCTAAAAGAGTGCTGG - Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1122076001 14:99234995-99235017 AAGTCCCTCTAGAAGAGAGACGG - Intronic
1122758664 14:104003473-104003495 ATATCTATCTAGAAGGGTGAAGG - Intronic
1123993077 15:25697971-25697993 TTGACCATTTTGAAGAGTGCTGG - Intronic
1125259837 15:37810638-37810660 TTGTACAACTTGAAGAGTAAAGG + Intergenic
1125414938 15:39442479-39442501 AATTCCATCTAGCAGAGTGAAGG - Intergenic
1125808211 15:42513421-42513443 TTGTTCATCCAGCATAGTGATGG - Exonic
1126269215 15:46793231-46793253 TTGTCCATTTAGGAAAGTCATGG - Intergenic
1126723365 15:51605996-51606018 TTGCTAATCTAAAAGAGTGAGGG + Intronic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1128977675 15:72165438-72165460 TTGTCCATCTGGAACAGGCAAGG + Intronic
1129453132 15:75661833-75661855 TTTCCCCTCTAGATGAGTGAAGG + Exonic
1131484892 15:92812009-92812031 ATATCAATTTAGAAGAGTGAGGG - Intergenic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1134662668 16:15996155-15996177 TTGTACATTTAGTAGAGAGAGGG + Intronic
1135849915 16:25953854-25953876 TTGTCCACCTTGAAAGGTGAGGG + Intronic
1135949727 16:26902908-26902930 TTCACCGTCTGGAAGAGTGATGG + Intergenic
1136931969 16:34426792-34426814 ATGCACATCCAGAAGAGTGAAGG + Intergenic
1136972603 16:34985023-34985045 ATGCACATCCAGAAGAGTGAAGG - Intergenic
1139564327 16:67763867-67763889 TTGTACATTTAGAAGAGACAGGG + Intronic
1139860128 16:70013628-70013650 TTCTCCACCTGGCAGAGTGAGGG - Intergenic
1140573962 16:76141402-76141424 TTGTCCCTCTAGAAAAGAGATGG + Intergenic
1141143852 16:81515343-81515365 TTTTCCATCTAGAAGCGTGAGGG - Intronic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1145231157 17:21174317-21174339 TTGTCCTTGTAGAATAGTGTGGG + Intronic
1147463876 17:40595142-40595164 ATGCCTATCTAGAAGAGTGAAGG - Intergenic
1152901177 17:82941892-82941914 TTGTTACTTTAGAAGAGTGACGG - Intronic
1153232026 18:2947373-2947395 TTGTCCTTCTAGAGGATGGATGG - Intronic
1153357504 18:4153919-4153941 TTGTCCAGGTTAAAGAGTGATGG + Intronic
1153881650 18:9426461-9426483 TTGTACTTTTAGAAGAGTCAGGG - Intergenic
1153965039 18:10172148-10172170 ATGTCTATCTAGAAAGGTGAAGG + Intergenic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1155701640 18:28751141-28751163 TTGAACATCAAGAAAAGTGAAGG - Intergenic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1160018686 18:75163990-75164012 TTGTCCAGCTGGGAGAGTGGAGG + Intergenic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1162225226 19:9215502-9215524 TTGTACATCTATTAGAATGAAGG - Intergenic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
1165687333 19:37833134-37833156 TTCTCCATCAAGTAGACTGAAGG - Intergenic
925532143 2:4875886-4875908 TTGTCCAGCTGGTAGAGTAATGG - Intergenic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
928081925 2:28319512-28319534 TTGTCCAGCTAGAACCCTGAGGG - Intronic
928118244 2:28563487-28563509 TTGTCCATGTAGAAAAGCTAAGG + Intronic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
929383886 2:41382438-41382460 TAGTCCATTTGCAAGAGTGAGGG - Intergenic
929442404 2:41974240-41974262 ATGACCAACTGGAAGAGTGAGGG + Intergenic
929572373 2:43030695-43030717 TAGTCCATCTAAAAGGGTGTTGG + Intergenic
931345560 2:61442093-61442115 TTGTTTATGTAGAGGAGTGAGGG - Intronic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
935298185 2:101669002-101669024 TTGTCCATATAGTAGAGTACAGG + Intergenic
937043242 2:118836838-118836860 TTGTCCATTTAGCAGAGTGCAGG - Intergenic
939036618 2:137139293-137139315 ATGTCCATCTAAAAGAATGGAGG - Intronic
942694923 2:178630936-178630958 TTCCCGATCTAGAAAAGTGAAGG + Exonic
943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
943445046 2:187974269-187974291 TTCTTCATCTAGAAGAGGGTGGG + Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
944251371 2:197582609-197582631 TTGTCCCTTTGCAAGAGTGAGGG - Intronic
944996519 2:205300968-205300990 TGGTCCTTGTAGAAAAGTGAAGG - Intronic
945554984 2:211265567-211265589 TAGTCCCTTTACAAGAGTGAGGG - Intergenic
947004971 2:225500754-225500776 TTGACCTTCTAGCAGAGAGATGG - Intronic
947286289 2:228519030-228519052 TTGTCCATCTAGAGAAGTAAGGG - Intergenic
948212332 2:236203985-236204007 GTGTCCATCTAGGGGAGAGATGG + Intronic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1171205098 20:23272923-23272945 CTGTGAATCTAGAAGAGTTATGG - Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1172322718 20:34009144-34009166 TTTTCCATTTATAAGAGTGGGGG + Intronic
1173400435 20:42721516-42721538 TTGTCCAACCAGAAGCCTGAGGG - Intronic
1175510054 20:59518079-59518101 TGGACCATCCAGAAGAATGACGG - Intergenic
1176864840 21:14041708-14041730 TTGTCCATATCAAAGAGTAATGG + Intergenic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1178679729 21:34663713-34663735 TTTTTCATCTGGAACAGTGAGGG - Intergenic
1180063110 21:45396562-45396584 TTGTCCATATTGATGAGAGAAGG - Intergenic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1181135245 22:20761042-20761064 TGGTCCCTCTAGATGAGTGCTGG + Intronic
1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG + Intergenic
1182959936 22:34462724-34462746 ATGTCCAACTAGCAGGGTGAAGG - Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
949271504 3:2223196-2223218 TTGTCCACCTAGAACAGTAAAGG - Intronic
949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG + Intronic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951762472 3:26161754-26161776 TTGTCCTTTTGCAAGAGTGAGGG + Intergenic
954055172 3:48017119-48017141 TTTTCCATCTATTAAAGTGAGGG - Intronic
955254955 3:57321635-57321657 TTATCCACCCAGAAGAGTAAAGG - Intronic
956327559 3:68070441-68070463 TTGTCCACCTAGGCCAGTGATGG + Intronic
956346053 3:68280267-68280289 TTGACCATTGAAAAGAGTGATGG - Intronic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
957902541 3:86513701-86513723 TTGTCCATTTAAAAGACTAATGG + Intergenic
957902994 3:86521200-86521222 TTTTCCATTTAGAAGGGTTATGG - Intergenic
959103386 3:102039401-102039423 CTTTCTATCTGGAAGAGTGAAGG + Intergenic
960969412 3:123129006-123129028 CTGTCCATCTACACGAGGGAGGG - Intronic
961122063 3:124381214-124381236 TTGGTCAAATAGAAGAGTGAAGG + Intronic
962324141 3:134419359-134419381 TGTTCCAAATAGAAGAGTGATGG + Intergenic
962568391 3:136687697-136687719 TTGTCTTTCTAGAAAAATGAAGG + Intronic
962894275 3:139699778-139699800 TTGTCCAGTTAGAGAAGTGAGGG + Intergenic
962905512 3:139797953-139797975 TTTTCCAGCTTGATGAGTGAGGG + Intergenic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965332603 3:167395138-167395160 TTATGCAACTAGAAGAATGAAGG + Intergenic
966495248 3:180572831-180572853 TTGTCCATCTAGCAGAAGTAGGG - Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967789076 3:193527842-193527864 TTGTCCATCTGTAACAGAGAGGG + Intronic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
969927561 4:10599392-10599414 TTGACCATCTAGAAAGATGATGG + Intronic
970761851 4:19498972-19498994 ATGACCATCTGGAAGACTGAAGG - Intergenic
971156152 4:24085480-24085502 TGGTCAATCTAGAAGTGAGAAGG - Intergenic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
973665845 4:53158473-53158495 TTGGTCAACTGGAAGAGTGATGG - Intronic
974018209 4:56669055-56669077 TTCTTAATCTAGAAAAGTGAAGG + Intronic
975084070 4:70316285-70316307 TTGTCCATTGTGAAAAGTGATGG - Intergenic
976385363 4:84451246-84451268 TGGACCATGTAGAAGATTGAAGG + Intergenic
978612706 4:110561391-110561413 CTCTCCATCTAGAAAAGAGAGGG - Exonic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979484506 4:121255198-121255220 TTGTCCCTCTAGAAGATCCAAGG + Intergenic
980896012 4:138861054-138861076 TTGCCCATCTGTAAAAGTGAGGG - Intergenic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
982149449 4:152436593-152436615 CTGTCCAGCTAGAAGAGTCATGG - Intronic
984553528 4:181187452-181187474 TTGTACTTCTAGAAAACTGAAGG + Intergenic
984809108 4:183778457-183778479 TTGACAATCAAGAAGAATGAAGG - Intergenic
986635264 5:9815371-9815393 TTGTGCATTAAGAAGAGAGAGGG - Intergenic
987852838 5:23379321-23379343 TTTTCCATCTAGTAAAGGGATGG - Intergenic
988190394 5:27923385-27923407 TTGGCCATTGAGAAGTGTGATGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990603135 5:57381435-57381457 TTGTCCATCTTTCAGAGAGAAGG - Intergenic
990963410 5:61418593-61418615 GTGACTATCTAGATGAGTGAGGG + Intronic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
994849111 5:105031100-105031122 TTTTCCATCAAGAAAAATGAAGG - Intergenic
999360741 5:150984548-150984570 TTGGCCATCTGGGAGAGAGATGG - Intergenic
999924069 5:156355964-156355986 TTTTTCTTCTAGAAGTGTGAGGG + Intronic
1000038561 5:157467577-157467599 TTTTCCACCTAAAAGAGTCAGGG - Intronic
1001179291 5:169503658-169503680 TTCTCCATCTATATGAGAGAAGG + Intergenic
1003785893 6:9486677-9486699 TTGACCTTCCAGCAGAGTGAGGG + Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1006562615 6:34926705-34926727 TTCTCCTCCTGGAAGAGTGAGGG - Intronic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1008455397 6:51705107-51705129 TTGTCCATATCAAAGAATGAGGG + Intronic
1009197201 6:60701473-60701495 TTCTCCATCCAAAAGAGGGAGGG + Intergenic
1009405229 6:63304259-63304281 ATGCCCATCTAGAAAGGTGAAGG - Intronic
1010296222 6:74199716-74199738 TTTTGCATCTTGAAGAATGAAGG + Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011153247 6:84299077-84299099 GTGCCCATTCAGAAGAGTGAAGG - Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1012920024 6:105211892-105211914 TTCTCCATCTATGAAAGTGAAGG - Intergenic
1013070452 6:106724311-106724333 TTTTACAACTGGAAGAGTGATGG + Intergenic
1013796974 6:113899110-113899132 TTGTACAGCTAGAATACTGAGGG - Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1015831327 6:137372239-137372261 ATGCCCATCTAGAATACTGAAGG + Intergenic
1016086280 6:139919367-139919389 TTGTACTTTTAGAAGAGAGATGG + Intergenic
1016744481 6:147563551-147563573 TTGTCCATCTAGATCTGTCAAGG + Intronic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1023824845 7:44002133-44002155 TTGTGCTTCTAGAAGAGACAGGG - Intronic
1026088394 7:67280907-67280929 TTGTGCTTCTAGAAGAGACAGGG - Intergenic
1026725858 7:72869434-72869456 TTGTCCTTCAAGAAGAGACAGGG + Intergenic
1027117996 7:75496212-75496234 TTGTGCTTCTAGAAGAGACAGGG - Intergenic
1027273809 7:76539248-76539270 TTGTGCTTCTAGAAGAGACAGGG + Intergenic
1027327256 7:77058302-77058324 TTGTGCTTCTAGAAGAGACAGGG + Intergenic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1028283618 7:88966514-88966536 TTATTGATATAGAAGAGTGACGG + Intronic
1028939378 7:96503846-96503868 TTCTTCAGCTAGAAGAGTAAGGG + Intronic
1029719507 7:102353834-102353856 TTGTGCTTCTAGAAGAGACAGGG + Intergenic
1029753108 7:102555438-102555460 TTGTGCTTCTAGAAGAGACAGGG - Intronic
1029771059 7:102654521-102654543 TTGTGCTTCTAGAAGAGACAGGG - Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1031085498 7:117298158-117298180 GTGGCCAGTTAGAAGAGTGAGGG + Intronic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1031760139 7:125703501-125703523 TTCTCCATCTAGAATATTTATGG - Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1035788509 8:2282087-2282109 TTCTACATCTAGGAGAGTGCTGG - Intergenic
1035804296 8:2439618-2439640 TTCTACATCTAGGAGAGTGCTGG + Intergenic
1038703254 8:29871017-29871039 TTATCCATCTACATGAGTCAGGG + Intergenic
1038905157 8:31893372-31893394 TTCTCCTTATAGTAGAGTGAAGG + Intronic
1039817969 8:41111405-41111427 ATGCCCACCTGGAAGAGTGAGGG - Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1041887790 8:62831817-62831839 CTGACCATCTAGCAGAGTTAAGG - Intronic
1043137330 8:76544641-76544663 ATGCCCATCCAGAAGAGTAAAGG - Intergenic
1043827090 8:84942282-84942304 ATGTCCTTCTAAAGGAGTGAAGG - Intergenic
1045533099 8:103002750-103002772 TAGTCCTTTTACAAGAGTGAGGG - Intergenic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1047097974 8:121644036-121644058 AAGTCAATCTAAAAGAGTGAAGG - Intergenic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051411878 9:16798077-16798099 TTGTTGATCTGGAAGTGTGAAGG + Intronic
1051794321 9:20847669-20847691 TTTTCCATGTAGAAGAGTTTTGG + Intronic
1052399418 9:27981684-27981706 TTGTCCATCTAGATTAGTGAAGG + Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG + Intergenic
1058047265 9:100369934-100369956 ATGTCCATCCAAAAGAGTGAAGG - Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1058692678 9:107532639-107532661 TTCTCCATTGAGAAAAGTGATGG + Intergenic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1186792013 X:13008796-13008818 TTTTCCCTCCAGAAGAGTAATGG - Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187234695 X:17456281-17456303 TTGTTCATCTAGAAGAGTCTGGG + Intronic
1187856240 X:23638155-23638177 TTCTCCATCTAGAGGAGAAAAGG + Intergenic
1191643885 X:63457795-63457817 ATGTCCATCTAGAATGATGAAGG + Intergenic
1192837897 X:74821516-74821538 TTGTTCATCTATAGGAGTAATGG - Intronic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1197500029 X:127230922-127230944 TAGTCCTTTTACAAGAGTGAGGG - Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1199441447 X:147872845-147872867 CTATCTATCTAGAAGAATGAAGG - Intergenic
1200734268 Y:6776901-6776923 TTGCCCTTTTAGAATAGTGAAGG + Intergenic
1202047079 Y:20746016-20746038 TGGTCAAACCAGAAGAGTGAAGG + Intergenic