ID: 1128605827

View in Genome Browser
Species Human (GRCh38)
Location 15:69036003-69036025
Sequence GGGCTCTGGAGTAAATCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128605827_1128605838 23 Left 1128605827 15:69036003-69036025 CCCTCTGATTTACTCCAGAGCCC 0: 1
1: 0
2: 2
3: 16
4: 158
Right 1128605838 15:69036049-69036071 ATATTATTTGCATGTGATTTGGG 0: 1
1: 0
2: 3
3: 40
4: 522
1128605827_1128605837 22 Left 1128605827 15:69036003-69036025 CCCTCTGATTTACTCCAGAGCCC 0: 1
1: 0
2: 2
3: 16
4: 158
Right 1128605837 15:69036048-69036070 CATATTATTTGCATGTGATTTGG 0: 1
1: 0
2: 4
3: 25
4: 295
1128605827_1128605832 -5 Left 1128605827 15:69036003-69036025 CCCTCTGATTTACTCCAGAGCCC 0: 1
1: 0
2: 2
3: 16
4: 158
Right 1128605832 15:69036021-69036043 AGCCCAGGAAGGTCCCAAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128605827 Original CRISPR GGGCTCTGGAGTAAATCAGA GGG (reversed) Intronic
901862222 1:12081547-12081569 GGGCTCTGGATTAAATAAGAAGG + Intronic
902915169 1:19634130-19634152 GGGCTCTGGAATAGATCTGCAGG + Intronic
903299199 1:22366011-22366033 GGGCTCTGGAGAGACTGAGACGG - Intergenic
904804408 1:33120615-33120637 GGGCTCAGGACTAAAGCAGAGGG - Intergenic
904907088 1:33905763-33905785 GAGCTCTGGAGTACAGGAGAGGG + Intronic
905345755 1:37309929-37309951 GGGCTCTGGAATAATACAGGGGG - Intergenic
905405911 1:37732288-37732310 GGGCTCTGCAGGGATTCAGAGGG - Intronic
905926801 1:41756810-41756832 GGATTCTGGAGTAAATGATACGG - Intronic
906271120 1:44479595-44479617 AAGCTCTGAAGGAAATCAGATGG - Intronic
906728037 1:48058260-48058282 GGTCTCTGGAGGAAACAAGATGG - Intergenic
907674478 1:56506115-56506137 CAGCCCTGGAGTAAATCAGAAGG + Intronic
908406264 1:63816952-63816974 GGGCACTGGACTACAACAGAGGG + Intronic
908677138 1:66617930-66617952 GGACTCTGGAGTCAGGCAGAGGG + Intronic
915663242 1:157421128-157421150 GGCATCTGGAATAAATAAGAAGG - Intergenic
915835251 1:159171397-159171419 GGGCTCGGGTGTGGATCAGAGGG - Intergenic
916503743 1:165409087-165409109 GGGCTCTGGATGATCTCAGAAGG - Intronic
918691845 1:187490554-187490576 GGGCTATTGAGTAAATGAAATGG - Intergenic
919225594 1:194696074-194696096 GGGCTTTGGAATAAGTCAGATGG - Intergenic
919751192 1:201039391-201039413 GGGCTGTGGAGAAAGACAGAGGG - Intergenic
920297977 1:204971025-204971047 GGGCTCTGAAGTTGTTCAGAGGG - Intronic
920555626 1:206902178-206902200 GGGCTTTGGAGCAAAGCTGATGG - Intronic
920700461 1:208214439-208214461 AGGCTTTGAAGTAAACCAGATGG - Intronic
921149184 1:212386260-212386282 GGGCTGTAGAGTAAATGAGGAGG - Intronic
921859787 1:220030391-220030413 GGCCTCTGGAGGAAATCTGACGG + Exonic
921945428 1:220882904-220882926 AGGCTCTGAAGAAAATCTGAAGG + Intronic
922008930 1:221561562-221561584 GGGCTCTGGAGAAAAGAATAGGG + Intergenic
924568601 1:245218370-245218392 GGGCTCAGGTGAAAAGCAGAAGG + Intronic
1064579083 10:16775332-16775354 AGGCTGTGGAGAAAATAAGACGG - Intronic
1066596290 10:37053700-37053722 GGGCTCTGGGGTGAATTATAAGG + Intergenic
1067011216 10:42715516-42715538 AGGCTGTGGAGAAAATAAGACGG + Intergenic
1067312369 10:45126327-45126349 AGGCTGTGGAGAAAATAAGATGG - Intergenic
1068504929 10:57888507-57888529 GGGCTCTGGTAGAAATGAGATGG - Intergenic
1073461014 10:103665929-103665951 GGGCTCTGTAATAAAGCACAAGG - Intronic
1074120356 10:110489546-110489568 GGGTTCTGGAGTAAAGGGGAAGG - Intergenic
1074509679 10:114100988-114101010 GGGCTCTGGACGGAAACAGAAGG + Intergenic
1075020943 10:118952026-118952048 GGGCTCTGAAGTAAATGACCTGG + Intergenic
1075248175 10:120843256-120843278 GGGCTGTGGAGTACATGACATGG + Intergenic
1075528185 10:123203352-123203374 GTGCCCTGGAGAAACTCAGATGG + Intergenic
1080799602 11:35598143-35598165 GGGCTCTGCAGTAAGTGAGTAGG - Intergenic
1080854286 11:36098334-36098356 GGGCGGTGGAGCAAAGCAGAGGG - Exonic
1082207323 11:49453800-49453822 GAGCTCTAAAGTAAATCAAAAGG - Intergenic
1082794663 11:57370479-57370501 GGGCGATGGAGTTAGTCAGACGG - Exonic
1084991479 11:72929548-72929570 GGGGGCTGGAGCAAATCATAGGG - Intronic
1085020735 11:73205206-73205228 GGGCACTGCAGGAAAACAGAAGG - Intergenic
1086867043 11:91992155-91992177 GAGATCTGAAGTAACTCAGATGG - Intergenic
1088021075 11:105120242-105120264 GGACACTGGAGTCAATAAGAGGG + Intergenic
1089593081 11:119557370-119557392 GGGCACTGGAGCAAAGCTGAGGG + Intergenic
1089644013 11:119866009-119866031 GGGCTGAGGAGTAAATAACAGGG - Intergenic
1090475236 11:127014209-127014231 AGGCTCAGGATTAAATCAAAAGG + Intergenic
1092222983 12:6728018-6728040 GTGCTCTGGAGTAATGGAGATGG + Intronic
1093079240 12:14790235-14790257 GTGCTCTGGAGAAAAACAGGTGG + Intronic
1094351281 12:29528345-29528367 GGACTCTGGTGTACAGCAGACGG - Intronic
1095539540 12:43292721-43292743 GGGCTCTGGAGTGACTGTGAAGG + Intergenic
1095546975 12:43383941-43383963 TGGCTCTGGAGTTCAGCAGAGGG - Exonic
1096788592 12:54031667-54031689 GGGCGCTGGAGGGAATCTGAAGG - Intronic
1102657147 12:114491564-114491586 GGGCTCTGGATTTAAGCAGATGG + Intergenic
1103808334 12:123592327-123592349 GGGCACTGAACTAACTCAGAGGG + Intronic
1103895713 12:124271849-124271871 GGGCTCTGGAGTGGATTAAATGG - Intronic
1104124969 12:125837715-125837737 GGGCCCTGGAAGAAAGCAGAGGG + Intergenic
1106006883 13:25778971-25778993 GAGCTCTGGAGACAAACAGATGG + Intronic
1107188848 13:37555893-37555915 GGGCTTTGGTGAAGATCAGATGG + Intergenic
1109323447 13:60837874-60837896 GGGCTATGGGTTAAATCACAAGG - Intergenic
1110064990 13:71092828-71092850 AGGCTCTGCAATAAATCAAATGG - Intergenic
1110244806 13:73310830-73310852 GGGCTCAGGAGCAAAATAGAGGG - Intergenic
1113569053 13:111340098-111340120 GCACTCTGGAGAAAATCAGTGGG - Intronic
1113946257 13:114045406-114045428 GGGGTCTGGAGGGCATCAGACGG + Intronic
1115399050 14:32938558-32938580 GCGCTCTGGAGCAAAGCAGCTGG + Intronic
1121442341 14:93956992-93957014 GGGCTCTGAACCAAAGCAGATGG + Intronic
1122350194 14:101084558-101084580 GGGCTTCTGAGTAAGTCAGATGG - Intergenic
1124271150 15:28281894-28281916 GGGCTCTGCAGCCAAGCAGAAGG - Intronic
1124372143 15:29110064-29110086 GGGCTCTGCAGAAAATCAGCTGG + Intronic
1124393825 15:29283158-29283180 GGGCTCTGGAGCAGATGAGAGGG + Intronic
1125122382 15:36177410-36177432 GCGCTCTGGAATACAACAGAAGG - Intergenic
1125447183 15:39770881-39770903 GGGCTCTGGGATAAGGCAGACGG + Intronic
1128605827 15:69036003-69036025 GGGCTCTGGAGTAAATCAGAGGG - Intronic
1128753634 15:70166345-70166367 GAGGTTTGGAGTAAGTCAGATGG + Intergenic
1131550875 15:93355788-93355810 GGGCTCTGTATTAACTCTGATGG + Intergenic
1132013879 15:98299433-98299455 GGGCTCTGTTGTAAATTAGAAGG + Intergenic
1135292916 16:21255562-21255584 GGGCTCTGGACTGCATCAAAGGG + Intronic
1137798129 16:51239085-51239107 AGGCTTTGAGGTAAATCAGAAGG + Intergenic
1139217346 16:65139683-65139705 GAGCTCAGCAGTAATTCAGATGG + Intergenic
1139474279 16:67194806-67194828 GGGCTCTGGAGCAAATCTTCAGG - Exonic
1139583892 16:67888770-67888792 GGGCTCTGGAGAAGAGCAGGAGG - Intronic
1141292582 16:82734013-82734035 GGGCTGTGGAGAAAATAAGGTGG + Intronic
1142832802 17:2561869-2561891 GAGCTCTGAAGTCAAGCAGAAGG - Intergenic
1142879682 17:2874646-2874668 GGATTCTGGAGGAAATGAGACGG + Intronic
1144771077 17:17759990-17760012 GGGCTGTAGAATAAAGCAGAAGG + Intronic
1148742552 17:49901172-49901194 GGACTCAGTAGGAAATCAGAAGG - Intergenic
1149687241 17:58543077-58543099 GGGCTCTGGAGTAACAAACATGG + Exonic
1153769006 18:8400616-8400638 TGGCTCTGGAGTAAGTGGGACGG - Intronic
1160489443 18:79324969-79324991 GGGCTGTGGAGTAAACCAGTGGG + Intronic
1164072476 19:21780766-21780788 GGGCACTGGGGCAAATCTGAAGG + Intergenic
1166752071 19:45169025-45169047 GGACACTGGAGGAAAGCAGATGG - Intronic
926854254 2:17235343-17235365 GGGTTGTTGAGTAAATCAAATGG + Intergenic
926969570 2:18453199-18453221 GGGGTCTGGAGGCAGTCAGAGGG + Intergenic
928103654 2:28453684-28453706 AGGCTCTGGAGTATAGAAGAGGG + Intergenic
929125719 2:38521232-38521254 TGGCTTTGAAGTACATCAGAAGG - Intergenic
929484616 2:42342474-42342496 GGGCTGTAAAGTAAAGCAGATGG - Intronic
930263748 2:49176327-49176349 GGGCTCTGGGGAAACGCAGAGGG - Intergenic
931552166 2:63458936-63458958 GGGCTATGGAGAAGATCAGTTGG - Intronic
932301663 2:70671707-70671729 GGGCTCTGGCCTCAAGCAGACGG + Intronic
936487633 2:112939947-112939969 GGGCCCTGGAGTAGGTGAGAAGG + Intergenic
937738375 2:125318963-125318985 TGGCTCTGGGGTAAACCTGAAGG + Intergenic
937870966 2:126785925-126785947 GGTATATGGAGTAAAGCAGATGG - Intergenic
938107847 2:128545355-128545377 GGGGACTGGAGAAGATCAGAGGG + Intergenic
938551007 2:132382496-132382518 GGGCTCATGAGGAAATCACAGGG + Intergenic
940041539 2:149366824-149366846 GGGCCCTGGAGAAAATCTGCAGG - Intronic
945416655 2:209581616-209581638 GCTCTCTGGATTTAATCAGATGG - Intronic
948388118 2:237594180-237594202 GTGCGCTCGTGTAAATCAGAAGG + Intronic
948845056 2:240679145-240679167 GGGCTCTGGAGCTGATCAGGAGG + Intronic
948848804 2:240695734-240695756 GGGCTCTGGAGCTGATCAGGAGG - Intronic
1169797735 20:9482728-9482750 GGGTGCTGGAGGAAATGAGATGG - Intergenic
1182656956 22:31898277-31898299 GGGCTCTGGGGTAGAGCAGCAGG - Intronic
1184893751 22:47395009-47395031 GGGCTCTGCAGAAAAGCAGCTGG + Intergenic
949788650 3:7769059-7769081 GGGCTCTGGATTAAAGGTGATGG - Intergenic
949953892 3:9251795-9251817 GGGTTTTGGAGTAAGTCAGATGG + Intronic
950683386 3:14600803-14600825 GAGCTCCGCACTAAATCAGAGGG - Intergenic
951082221 3:18465962-18465984 GGACTCTGGAGAAGATCAAATGG + Intergenic
955940574 3:64143542-64143564 TGGCTCATGAGGAAATCAGAAGG - Intronic
959116150 3:102181033-102181055 GTTGTCTGGATTAAATCAGATGG + Intronic
964743067 3:159987950-159987972 GGGGTCAGGAGTAGAGCAGAGGG - Intergenic
967174641 3:186852227-186852249 GGGCACTGGAGAAACACAGAGGG + Intronic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
969170341 4:5357197-5357219 AGGCTCTGAAGTAAACCAAATGG + Intronic
969475652 4:7421185-7421207 GGGCTCTGCAGTGAGTCAGAGGG + Intronic
969513838 4:7635247-7635269 GGGCTCTGGAGTCAAACACTCGG + Intronic
969537505 4:7765716-7765738 TGGCTCTGGAGGACAGCAGAAGG + Intronic
970866668 4:20766833-20766855 GGGCTCTGGAGTTAAATAGAAGG + Intronic
972771481 4:42201295-42201317 GCGCCCTGGGGTAAACCAGAGGG + Intergenic
975802792 4:78079832-78079854 TGGCTGTGTAGTAAATCATAAGG - Intronic
975828725 4:78346930-78346952 GGGCCCTGGAGGAAAGAAGATGG - Intronic
976781337 4:88761956-88761978 GGGCTCTGGAGAAAAATAAAGGG + Intronic
981363947 4:143879481-143879503 GGGCTTTGGAGTAAAACAGATGG + Intronic
981374672 4:144000254-144000276 GGGCTTTGGAGTAAAAGAGTTGG + Intronic
981385000 4:144119557-144119579 GGGCTTTGGAGTAAAAGAGATGG + Intronic
983130940 4:164019392-164019414 GGGCTGTGGTGGAAAACAGATGG - Intronic
983933711 4:173480433-173480455 GGGCTCTGGATTAAAAAAGATGG + Intergenic
984626014 4:182009038-182009060 AGGCACAGGAGCAAATCAGATGG - Intergenic
986444655 5:7810809-7810831 AGGCTCTGGAGTGCAGCAGAAGG - Intronic
986955352 5:13143615-13143637 GGGCACTGGAGTACATAATAGGG + Intergenic
987087435 5:14483679-14483701 GGGCTCTGGAGCCAAACAGCTGG + Intronic
989273281 5:39556851-39556873 GGCATGTGGAGTAAATCAAATGG + Intergenic
993230925 5:85235196-85235218 GGGCTCTGGATTTATTAAGAAGG + Intergenic
993390216 5:87311761-87311783 GACCTCTGGAGTCAAACAGATGG - Intronic
993639934 5:90390527-90390549 GGGCTCTAGAGTAAAACAGCTGG + Intergenic
1003202096 6:3970667-3970689 GCACTCTGCAGTAAATCAGGTGG + Intergenic
1007117043 6:39350152-39350174 GGCCTCTTGGGAAAATCAGACGG + Intronic
1012648982 6:101728541-101728563 GGGCTCTAAAGAAAACCAGATGG + Intronic
1015611522 6:135025906-135025928 GGGCTCAGGAGAAGAACAGAGGG + Intronic
1017950200 6:159129675-159129697 GGCCTCTGGAGGAAGGCAGATGG + Intergenic
1019383455 7:740319-740341 GGACTCTGGAGGAAACCAGTAGG - Intronic
1020390762 7:7655472-7655494 GGACTCTGGAGGAATGCAGAGGG - Intronic
1023535514 7:41204502-41204524 GGGCTGTGGAGTCAGCCAGAAGG + Intergenic
1024825809 7:53388022-53388044 GGGCCCTGGAATAAAGGAGAAGG - Intergenic
1026525886 7:71153115-71153137 GGGCTTTGGAGTTAGACAGAAGG + Intronic
1027621056 7:80485593-80485615 GGGCTCAGCAGTAACTGAGATGG - Intronic
1030755787 7:113286107-113286129 GGGTTGTGGAGTAACTGAGAAGG + Intergenic
1034862560 7:154612096-154612118 GGTCTCTGGAGGAAGGCAGAAGG - Intronic
1039087401 8:33793635-33793657 TTGCCCTGGAGTAAATCACACGG + Intergenic
1040332856 8:46401174-46401196 GGGATGTTGAGAAAATCAGAGGG - Intergenic
1041719368 8:60962236-60962258 GAGCTCTGAAGTAACTCAAAAGG - Intergenic
1044538948 8:93389095-93389117 GGGCTCTGGAGTCAGTTAGCTGG - Intergenic
1046715617 8:117563343-117563365 GGCCTCTGGAGTAAACAAGGGGG + Intergenic
1046872650 8:119220718-119220740 GGGCTATGGGGTAAAGCAGAGGG - Intronic
1049053973 8:140220485-140220507 GGGCTCTGCAGTAAAGAAGGGGG - Intronic
1050085741 9:1963928-1963950 GGGCACTGTAGGAAAGCAGACGG - Intergenic
1051681918 9:19616112-19616134 GGGAACTGGAGAAAATTAGAGGG + Intronic
1058968623 9:110059762-110059784 GCCCTCTGGAGCAGATCAGATGG - Intronic
1059711075 9:116868223-116868245 GGGCTCTTGTGAAAATCACAGGG - Intronic
1061543003 9:131288475-131288497 AGGCTCTGGAGTCAGACAGACGG - Intergenic
1062329458 9:136031303-136031325 AGGCTGTGGAGTAAAGGAGAGGG - Intronic
1188620504 X:32216419-32216441 GGCCTCTGGACTATTTCAGAAGG + Intronic
1189253990 X:39623181-39623203 GGGCTCTGGGATCAATCAGCCGG + Intergenic
1194197812 X:90916819-90916841 GGGCTCTGAAGTCAAGAAGAAGG + Intergenic
1198233707 X:134716792-134716814 AGTCTCTGGAGTCAAACAGACGG + Intronic
1199543436 X:148982660-148982682 GGGCTCTGCAGGAAATTATATGG + Intronic
1200543928 Y:4495999-4496021 GGGCTCTGAAGTCAAGAAGAAGG - Intergenic