ID: 1128608981

View in Genome Browser
Species Human (GRCh38)
Location 15:69058794-69058816
Sequence TTCCCAAGCCTGATGAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 133}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128608981_1128608991 24 Left 1128608981 15:69058794-69058816 CCCCTCTTCATCAGGCTTGGGAA 0: 1
1: 0
2: 1
3: 16
4: 133
Right 1128608991 15:69058841-69058863 GCACAGAAGGAAACTAAAGAGGG 0: 1
1: 0
2: 3
3: 40
4: 461
1128608981_1128608989 11 Left 1128608981 15:69058794-69058816 CCCCTCTTCATCAGGCTTGGGAA 0: 1
1: 0
2: 1
3: 16
4: 133
Right 1128608989 15:69058828-69058850 AACGCTCTCTGGGGCACAGAAGG 0: 1
1: 0
2: 2
3: 15
4: 172
1128608981_1128608990 23 Left 1128608981 15:69058794-69058816 CCCCTCTTCATCAGGCTTGGGAA 0: 1
1: 0
2: 1
3: 16
4: 133
Right 1128608990 15:69058840-69058862 GGCACAGAAGGAAACTAAAGAGG 0: 1
1: 0
2: 1
3: 27
4: 341
1128608981_1128608986 0 Left 1128608981 15:69058794-69058816 CCCCTCTTCATCAGGCTTGGGAA 0: 1
1: 0
2: 1
3: 16
4: 133
Right 1128608986 15:69058817-69058839 GGCTTGGACAAAACGCTCTCTGG 0: 1
1: 0
2: 0
3: 4
4: 63
1128608981_1128608988 2 Left 1128608981 15:69058794-69058816 CCCCTCTTCATCAGGCTTGGGAA 0: 1
1: 0
2: 1
3: 16
4: 133
Right 1128608988 15:69058819-69058841 CTTGGACAAAACGCTCTCTGGGG 0: 1
1: 0
2: 0
3: 4
4: 120
1128608981_1128608987 1 Left 1128608981 15:69058794-69058816 CCCCTCTTCATCAGGCTTGGGAA 0: 1
1: 0
2: 1
3: 16
4: 133
Right 1128608987 15:69058818-69058840 GCTTGGACAAAACGCTCTCTGGG 0: 1
1: 0
2: 0
3: 7
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128608981 Original CRISPR TTCCCAAGCCTGATGAAGAG GGG (reversed) Intronic
900184499 1:1326674-1326696 TGCGCAATCCTGATGAAGGGTGG + Intronic
900718266 1:4158882-4158904 TTCTACAGCCTGAAGAAGAGGGG - Intergenic
901126261 1:6930843-6930865 TTCCCACGCCTGGTGAAGAGTGG - Intronic
903469844 1:23579065-23579087 TCACCACGCCTGATGCAGAGTGG - Intergenic
903929019 1:26851581-26851603 TTGCCAAGCCTGAGGCAGAAAGG + Intronic
904316968 1:29671793-29671815 TTCCCACGGCTGGTGAGGAGCGG + Intergenic
904442125 1:30538916-30538938 TTCCCACGGCTGGTGAGGAGCGG - Intergenic
905445763 1:38027642-38027664 TTCCCAAGCCTACTGCTGAGAGG + Intergenic
905886364 1:41494159-41494181 TCCCCAAGGCTGATCCAGAGAGG + Intergenic
907186124 1:52610568-52610590 TTGCCCAGGCTGAAGAAGAGTGG + Intergenic
908742369 1:67342036-67342058 TTCCCAAGCCTGCCTGAGAGTGG - Intronic
913481587 1:119294116-119294138 TTAAGAAGCCTGAGGAAGAGAGG - Intergenic
916194389 1:162209933-162209955 TAGCCAAGGCTGATGCAGAGTGG + Intronic
920762305 1:208796809-208796831 TTTCCAAACCTGGTGATGAGGGG + Intergenic
921383252 1:214546087-214546109 ATACCAAGCCTGAGGAACAGGGG + Intronic
924604378 1:245520320-245520342 TTCCCAAGCCTCTGGGAGAGGGG - Intronic
924687992 1:246315679-246315701 TTACAAAGCATGATGAAGAAAGG - Intronic
1064087956 10:12359585-12359607 TTGCCCAGGCTGATGGAGAGAGG - Intronic
1064362838 10:14681218-14681240 GGCCCAGGCCTGCTGAAGAGGGG - Intronic
1070394045 10:75996409-75996431 TTGCCAATTCTGAAGAAGAGGGG - Intronic
1072627346 10:97121304-97121326 TTCCCAAGTCTGCAGAAGGGAGG - Intronic
1074300360 10:112227585-112227607 TTCCCATCCCTGAAGAAGATGGG + Intergenic
1074998815 10:118779978-118780000 TCCACAAGACTGATGAAGAGAGG - Intergenic
1078471286 11:11588921-11588943 TGCCCAGGCCTGATGAAGCAGGG + Intronic
1079634792 11:22723140-22723162 TTCCCATGCCAGCTGAAGACTGG - Intronic
1080883845 11:36347601-36347623 TTGCTGAGCCTGAAGAAGAGAGG + Intronic
1082217004 11:49583508-49583530 TTGCCCAGGCTGAAGAAGAGTGG + Intergenic
1084692406 11:70734852-70734874 TTCCCAAGCCTGGGGGAGGGTGG - Intronic
1086632550 11:89040659-89040681 TTGCCCAGGCTGAAGAAGAGTGG - Intronic
1088558003 11:111082652-111082674 CTCCCTTGCCTGATGATGAGGGG - Intergenic
1091627113 12:2129851-2129873 TTCCCAAGCCTGCAGGAGAGAGG - Intronic
1092677029 12:10931300-10931322 TTCCCAACCCTATTTAAGAGAGG - Intronic
1092793438 12:12088773-12088795 CTCCCAACCCCGATGCAGAGCGG + Intronic
1097351657 12:58555768-58555790 ATCCAAAGACTAATGAAGAGAGG - Intronic
1097892871 12:64795457-64795479 TTGCCCAACCTTATGAAGAGAGG + Intronic
1100112094 12:91257964-91257986 TTCCCATGCCTAATGAACATGGG + Intergenic
1101145342 12:101835373-101835395 TTCCCATGCCTGGTCAAGAGTGG - Intergenic
1103909720 12:124345513-124345535 CTCCGAAGCCTGCTGAAAAGAGG - Intronic
1108498653 13:51048804-51048826 TAGCCAAGCCTGCTGAAAAGAGG + Intergenic
1109015955 13:57014509-57014531 CTGCCAATCCTCATGAAGAGGGG - Intergenic
1115909164 14:38236330-38236352 TGTCCAGGACTGATGAAGAGGGG - Intergenic
1118766462 14:68912832-68912854 GTTCCCAGCCTGATGAAGAGGGG + Intronic
1118901805 14:69992508-69992530 TTCCCAAACCTGAAAATGAGTGG - Intronic
1119468146 14:74875974-74875996 TGCCCAGGGCTGGTGAAGAGTGG - Intergenic
1121566013 14:94909828-94909850 TCCAAAAGCCTGACGAAGAGTGG + Intergenic
1124430991 15:29608450-29608472 TTCCCAAGACTGATCAGGAAGGG - Intergenic
1125919848 15:43518843-43518865 CTCCCAGGCCTGAAAAAGAGAGG + Intronic
1127210077 15:56765070-56765092 ATCACAAGCATGATGATGAGAGG - Intronic
1128608981 15:69058794-69058816 TTCCCAAGCCTGATGAAGAGGGG - Intronic
1131627239 15:94134411-94134433 TTCCCCAGGCTGATGAAGACTGG + Intergenic
1132026098 15:98405589-98405611 TCCCCAAGTCTGATGAAAACTGG + Intergenic
1134849958 16:17471127-17471149 TTCCCAAGGCGGAAAAAGAGAGG + Intergenic
1137738258 16:50741317-50741339 TTCCCAAGGATGGTGAAGAAGGG - Intergenic
1138595254 16:58026174-58026196 TTCCCAAGCCCGAGGAGAAGCGG - Exonic
1140647669 16:77050634-77050656 CTACCAAGCCTGTTGATGAGGGG - Intergenic
1143881272 17:10031835-10031857 TTCCAAAACATGCTGAAGAGTGG - Intronic
1144362965 17:14513444-14513466 TTTCCAAGACTCATGATGAGTGG - Intergenic
1145888503 17:28398698-28398720 TTCCCCAGGCCCATGAAGAGAGG + Exonic
1145979555 17:29003737-29003759 GTGCCAAGCCTGAGGATGAGAGG - Intronic
1148541774 17:48486656-48486678 CTCCAAAGCATGTTGAAGAGCGG + Intergenic
1149401586 17:56301951-56301973 TTGCCAAGACTGTTGAAGAGTGG - Intronic
1152515292 17:80819984-80820006 TCCCCAAGCCTCAGGAAGAGAGG - Intronic
1154367592 18:13726001-13726023 TTCCGAAGCCAGTTGAAGAGGGG - Intronic
1158052702 18:53242447-53242469 TTCCCAAGTAAGTTGAAGAGGGG + Intronic
1160907363 19:1457770-1457792 TTCCCAAGGCTGAGTGAGAGAGG + Intronic
1162742135 19:12779292-12779314 TTCTCAGCCCTGATGAAGACTGG - Intronic
1167437812 19:49490053-49490075 TCCCCAACCCTGGGGAAGAGTGG - Intronic
1168312738 19:55469223-55469245 TTCCCAACCCAGACGCAGAGGGG + Intergenic
926972458 2:18480454-18480476 TGCCCAAGCTTGTGGAAGAGCGG + Intergenic
927510362 2:23640559-23640581 TCCCCAAGCCTGAAGAGGGGAGG - Intronic
930272197 2:49270052-49270074 TTACAAAGCTTGAGGAAGAGTGG - Intergenic
932576059 2:72963055-72963077 TTCTCAAGCAAGATGAGGAGCGG + Intronic
934736352 2:96691709-96691731 CTCGCAAGCCTGAGGAACAGAGG - Intergenic
935109745 2:100081548-100081570 TTCCTAAGCCAGATGATGAGGGG - Intronic
935925558 2:108065000-108065022 GTCCCTAGCCTCATGCAGAGAGG - Intergenic
936125229 2:109783661-109783683 TTCCTAAGCCAGATGATGAGGGG + Intergenic
936219464 2:110587807-110587829 TTCCTAAGCCAGATGATGAGGGG - Intergenic
941008024 2:160267316-160267338 TTCCCAAGCCTGTTTCAGATAGG - Intronic
945890041 2:215420734-215420756 TCCACAAGCGTCATGAAGAGGGG - Exonic
945949069 2:216021597-216021619 TTCCCAAGCCTCTGGAAAAGGGG - Intronic
946879323 2:224161471-224161493 TTCCCAAGAATGATAGAGAGTGG - Intergenic
948087043 2:235259454-235259476 ATCCCAGCCCTGATGGAGAGAGG + Intergenic
948610067 2:239161363-239161385 TTCCCAACCTTGATGGGGAGGGG - Intronic
948756815 2:240164897-240164919 TTCCCCAGCCAGAGGAAGAAGGG + Intergenic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1169705761 20:8502958-8502980 TCCCCAGGATTGATGAAGAGAGG - Intronic
1169733508 20:8812192-8812214 TTCCAAGGCCTGAGGAAGAAGGG - Intronic
1170045945 20:12085330-12085352 TTCCCAAGATTGCTGGAGAGTGG + Intergenic
1171436566 20:25129586-25129608 TTCCCATGCCTGATGCCAAGAGG - Intergenic
1172093568 20:32449826-32449848 CTCCCAAGCATGACGCAGAGGGG - Intronic
1172606017 20:36214547-36214569 GTCCCATGCCTGATGCAGCGAGG - Intronic
1174868087 20:54157324-54157346 TTCACAAGGCAGAAGAAGAGAGG - Intronic
1175343164 20:58248131-58248153 CTGACAAGTCTGATGAAGAGCGG + Intergenic
1175815555 20:61881554-61881576 TTCCAAAGGCAGATGAACAGCGG - Intronic
1178246406 21:30957191-30957213 TTCCCAAGACAGATAAAGAGTGG + Intergenic
1181682223 22:24503345-24503367 TTCCCCAGGGTGATGATGAGGGG - Intronic
1184179823 22:42813198-42813220 TTCCCAAGCCTCATGAGGGCAGG - Intronic
950544790 3:13631913-13631935 TTCCCAACCCTGGTGCAGAAGGG + Intronic
952378392 3:32785582-32785604 TACTCCAGCCTGGTGAAGAGAGG + Intergenic
952423341 3:33150731-33150753 TTCCAAAGCTTGCTGAAAAGAGG + Exonic
952652588 3:35744307-35744329 TTCCCTAGCCTTAAGAACAGAGG - Intronic
952819957 3:37477761-37477783 TTGGCAAGTCTGATGAAAAGGGG - Intronic
960639701 3:119813582-119813604 TTGCCAAGCCTGGTCAAGTGGGG + Intronic
961464476 3:127072936-127072958 TTCCCAAGCCAAATGGAGGGTGG + Intergenic
965152009 3:164989624-164989646 ATCACAAGACAGATGAAGAGAGG + Intronic
968592774 4:1467133-1467155 TGTTCAAGCCTGCTGAAGAGGGG - Intergenic
968629992 4:1645361-1645383 CTCCCAACCCTGCAGAAGAGAGG + Intronic
969502345 4:7560723-7560745 TCCTCAAGCCTGCTGGAGAGGGG + Intronic
969509153 4:7607742-7607764 TTCCCATGCTTGTTGATGAGGGG + Intronic
975489151 4:74969637-74969659 CTCCCCTGCCTGATGAAGAAAGG - Intronic
975545604 4:75557266-75557288 TTACAAAGCCTCCTGAAGAGCGG - Intronic
976300601 4:83512157-83512179 ATCCCATGCCTGGTGAAGAAAGG - Intronic
982156623 4:152529188-152529210 GTCCCAAGCCTAAGGATGAGTGG - Intronic
985147538 4:186908317-186908339 ATCACAAGCCTCATGAAGATGGG - Intergenic
985921305 5:2978277-2978299 ATCACAAGCATGATGAAGAATGG + Intergenic
988768919 5:34411389-34411411 TTCCCAAGCCTTGTAATGAGGGG + Intergenic
990909086 5:60835963-60835985 TGCCCAGGCATGATGAACAGTGG - Intronic
998146236 5:139730439-139730461 TTCCCAACCCTCATGGAGGGGGG - Intergenic
998523870 5:142825051-142825073 TTTCCAAGCTTGAAGGAGAGGGG - Intronic
1000134671 5:158335867-158335889 TTCCCAAACCTCACTAAGAGAGG - Intergenic
1002667726 5:180838281-180838303 TGCCCAAGCAAGGTGAAGAGGGG + Intergenic
1003422402 6:5970155-5970177 TTCTGAAGACTGATGAATAGAGG + Intergenic
1006275999 6:33006179-33006201 GTCCCATGCATGATAAAGAGAGG - Exonic
1006521789 6:34575110-34575132 AGCCCAAGCCTGGAGAAGAGAGG - Intergenic
1007118786 6:39363312-39363334 TTCTCAAGCCTGATGAACGCAGG + Intronic
1010989815 6:82468215-82468237 TTCTGAGGCCTCATGAAGAGAGG + Intergenic
1011618034 6:89215902-89215924 TTCCCAAGCCAGAGTTAGAGTGG - Intronic
1015773041 6:136788347-136788369 TTCCCAAGGCTGATGCAGAATGG - Intronic
1022828290 7:34039036-34039058 TTCACAAGCCTGAAGAAAAGTGG + Intronic
1024767798 7:52681650-52681672 TTGCTAAGCATGATGTAGAGGGG - Intergenic
1025036945 7:55599477-55599499 TTCCCAAACTTGATAGAGAGGGG + Intergenic
1028847247 7:95495896-95495918 TTCACAAGCCACGTGAAGAGGGG - Exonic
1031633699 7:124075996-124076018 CTCCCAAACCTCATGAAGTGTGG + Intergenic
1035561742 8:609772-609794 TTGCCAGGGCTGGTGAAGAGAGG - Intergenic
1037030530 8:14098866-14098888 TACTCAAGCCTTATGATGAGTGG + Intronic
1038450805 8:27637682-27637704 CTCCCACGCCTGAGGAACAGAGG - Intronic
1043050857 8:75383809-75383831 TTCCCAACCCTGATGCAAACAGG - Intergenic
1048818250 8:138354438-138354460 TTCACAAGCCAGATAAAGACTGG - Intronic
1050488474 9:6161641-6161663 TTCCCAGCCCTGAGGAAGAGAGG + Intergenic
1051224999 9:14889898-14889920 ATCCTAAGCTTGATGAAGAGTGG + Intronic
1055451265 9:76433341-76433363 CTCCACAGCCTGATGAACAGGGG - Intronic
1056136361 9:83633029-83633051 TTCCAAGGCCTGATCAAGATTGG + Intronic
1056845118 9:90030905-90030927 TTCCAAAGCTTGAAGAGGAGAGG - Intergenic
1057167126 9:92937770-92937792 TTCTCAAGCCTGGTGAGCAGCGG + Intergenic
1059869472 9:118555625-118555647 TTGCCCAGCCTGCTGAACAGTGG - Intergenic
1061649001 9:132031047-132031069 TTCCAAAGACTGAGGAAGTGGGG + Intronic
1061663899 9:132148956-132148978 TTCCCACAGCGGATGAAGAGGGG - Intergenic
1062461330 9:136663730-136663752 CTCCCCAGCCTCATGCAGAGTGG + Intronic
1189084378 X:38005143-38005165 TTTCCAAGCCTGATGAATTTGGG - Intronic
1191208697 X:57861722-57861744 TTGCCAAGGCTGATGTTGAGAGG - Intergenic
1200230134 X:154439783-154439805 TTCCCCACCTGGATGAAGAGGGG - Intronic