ID: 1128610249

View in Genome Browser
Species Human (GRCh38)
Location 15:69067345-69067367
Sequence TCCCTTCCTGGTCTTTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128610249_1128610257 22 Left 1128610249 15:69067345-69067367 CCCCACCAAAGACCAGGAAGGGA No data
Right 1128610257 15:69067390-69067412 CTGAAGTCATTCCTGCCATATGG No data
1128610249_1128610254 -7 Left 1128610249 15:69067345-69067367 CCCCACCAAAGACCAGGAAGGGA No data
Right 1128610254 15:69067361-69067383 GAAGGGAGAGAAGCAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128610249 Original CRISPR TCCCTTCCTGGTCTTTGGTG GGG (reversed) Intergenic
No off target data available for this crispr