ID: 1128610404

View in Genome Browser
Species Human (GRCh38)
Location 15:69068422-69068444
Sequence TCACTTCGCTGGTGCCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128610401_1128610404 -9 Left 1128610401 15:69068408-69068430 CCAGGATAAGTCACTCACTTCGC No data
Right 1128610404 15:69068422-69068444 TCACTTCGCTGGTGCCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128610404 Original CRISPR TCACTTCGCTGGTGCCTTGA GGG Intergenic
No off target data available for this crispr