ID: 1128612285

View in Genome Browser
Species Human (GRCh38)
Location 15:69083788-69083810
Sequence CCATTAAGGGACAAGCTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128612280_1128612285 1 Left 1128612280 15:69083764-69083786 CCACTGGGTATGGGAAGCAGCCA No data
Right 1128612285 15:69083788-69083810 CCATTAAGGGACAAGCTACCTGG No data
1128612277_1128612285 14 Left 1128612277 15:69083751-69083773 CCGTCATTGGCAGCCACTGGGTA No data
Right 1128612285 15:69083788-69083810 CCATTAAGGGACAAGCTACCTGG No data
1128612274_1128612285 25 Left 1128612274 15:69083740-69083762 CCAAAGCAGCTCCGTCATTGGCA No data
Right 1128612285 15:69083788-69083810 CCATTAAGGGACAAGCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128612285 Original CRISPR CCATTAAGGGACAAGCTACC TGG Intergenic
No off target data available for this crispr