ID: 1128620285

View in Genome Browser
Species Human (GRCh38)
Location 15:69143317-69143339
Sequence GTCTCCTAGAAACCAACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128620281_1128620285 18 Left 1128620281 15:69143276-69143298 CCAGGACACAAAGCTTTATAAAT No data
Right 1128620285 15:69143317-69143339 GTCTCCTAGAAACCAACCCAAGG No data
1128620280_1128620285 23 Left 1128620280 15:69143271-69143293 CCTGTCCAGGACACAAAGCTTTA No data
Right 1128620285 15:69143317-69143339 GTCTCCTAGAAACCAACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128620285 Original CRISPR GTCTCCTAGAAACCAACCCA AGG Intergenic
No off target data available for this crispr