ID: 1128623117

View in Genome Browser
Species Human (GRCh38)
Location 15:69168992-69169014
Sequence AATGACTAAGAGAGTACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 257}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128623117 Original CRISPR AATGACTAAGAGAGTACAGG AGG (reversed) Intronic
900308806 1:2023725-2023747 AATGATTCTGAGAATACAGGGGG + Intronic
903069977 1:20722303-20722325 ACTGACTCAGAGAGGGCAGGGGG - Intronic
905357718 1:37396400-37396422 AAGTCCTTAGAGAGTACAGGAGG + Intergenic
906334878 1:44920387-44920409 AATAACTAAGAGAGTATAATTGG - Intronic
906864239 1:49398848-49398870 AATAACTAAAAGAGTACAATTGG - Intronic
911132957 1:94409204-94409226 AATAACTAAAAGAGTACAATTGG + Intergenic
912382744 1:109256022-109256044 ACTGATTAAGAGAGGAGAGGGGG - Intronic
912621891 1:111168995-111169017 AATGACTTAAAGTATACAGGAGG - Intronic
913191477 1:116416796-116416818 AATGACTAAAAGGTTACAGAAGG + Intergenic
916689127 1:167173700-167173722 AATGAGTCAGAGAGCACTGGGGG - Intergenic
917473564 1:175348034-175348056 AATCAATAAGAGAGTTCAGCAGG + Intronic
918770208 1:188547457-188547479 AATAACTAAGAAAATACAGTTGG - Intergenic
922563749 1:226587748-226587770 AATGAGGAAGAGTGGACAGGTGG - Intronic
922642666 1:227249936-227249958 AATAACTAAAAGAGTACAACTGG + Intronic
923695550 1:236246739-236246761 AATGACTAGGAAAGTACACATGG + Intronic
924471255 1:244344484-244344506 AAAGACTAAGAGAGTACAGATGG - Intergenic
924542452 1:244994237-244994259 AATGACAAAGAGATTACAAAAGG - Intronic
1062953217 10:1521339-1521361 AATGTCTAAGACAGTACAGGTGG - Intronic
1063885299 10:10571633-10571655 AATGACTGGGAGGGTACATGGGG + Intergenic
1064783784 10:18871530-18871552 AATAACTAAAAGAGTACAAATGG - Intergenic
1065257040 10:23880587-23880609 AATAACTAAAAGAGTATAGCTGG + Intronic
1068000001 10:51321742-51321764 AATGACTAAAAGAGTATATTTGG + Intronic
1070201708 10:74212956-74212978 AATGAGTTAGGGAGTATAGGAGG + Intronic
1073072409 10:100803081-100803103 AAAGAAGAAGAGAGTAAAGGAGG - Intronic
1073282183 10:102362712-102362734 AACGACTCAGAGAGTAGAGAAGG - Intronic
1075345535 10:121679441-121679463 CTTGACCAAGAGAATACAGGTGG + Intergenic
1076047137 10:127303295-127303317 AATGACTTAGACAGCAAAGGTGG + Intronic
1076166114 10:128284256-128284278 ATTGACTGAGAGAGGAGAGGAGG + Intergenic
1076268919 10:129133407-129133429 AATGACAAAGGGGGTGCAGGGGG + Intergenic
1076377189 10:129999130-129999152 AATAACTAAAAGAGTACAATTGG + Intergenic
1077638982 11:3864161-3864183 ACTCAATAAGAGAGTACAGCTGG - Intronic
1078681164 11:13477638-13477660 AATTAATAAGAGAGTCCAGCAGG + Intergenic
1078742780 11:14082873-14082895 GATGACTAATAAAGGACAGGGGG - Intronic
1079478856 11:20859787-20859809 AACTAATAAGAGAGCACAGGAGG + Intronic
1081006596 11:37751994-37752016 AATAACTAAGAGAGTATAATTGG + Intergenic
1081108734 11:39105385-39105407 AGTAACTAAAAGAGTACAGTTGG + Intergenic
1081555260 11:44154148-44154170 AATGACTAAAAGACTATAGTTGG - Intronic
1082132308 11:48505874-48505896 AATAACTAAAAGAGTATAAGTGG + Intergenic
1082565773 11:54676494-54676516 AATAACTAAAAGAGTATAAGTGG + Intergenic
1085106972 11:73853227-73853249 AATAACTAAAAGAGTATAGTTGG + Intronic
1085571495 11:77561762-77561784 AATAACTGAGGGAGTACAGTTGG - Intronic
1087177749 11:95110715-95110737 AATGTCTTAGAATGTACAGGAGG - Intronic
1087345618 11:96967100-96967122 AATAACTAAAAGAGTATAGTTGG + Intergenic
1087509930 11:99078927-99078949 AATCACTAAAAGAGTATAAGTGG + Intronic
1088163489 11:106902830-106902852 AATGACTTAAAGTATACAGGAGG + Intronic
1088835154 11:113571713-113571735 AACAAATAAGAGAGCACAGGAGG + Intergenic
1088860650 11:113796111-113796133 AATGAATAAGAGAGATCAAGTGG - Intergenic
1088866586 11:113853500-113853522 AATATCTACGAGAGTATAGGAGG - Intronic
1088903289 11:114134961-114134983 AATGACTCAGTGAATACTGGTGG - Intronic
1088924893 11:114291804-114291826 AATGGCTAAGAGAGTAAAGGTGG - Intronic
1089291762 11:117441618-117441640 AGTGCCTCAGAGAGTAGAGGAGG + Intronic
1089718593 11:120389612-120389634 AATAACTAAAAGAGTACAACTGG - Intronic
1090899944 11:131020288-131020310 AATGACTTAGAGAGTACAATTGG + Intergenic
1092099030 12:5868046-5868068 AATAACTAAAAGAGTACAATTGG + Intronic
1092476647 12:8824500-8824522 AATTACTAAGAGAGTATAATTGG - Intronic
1092957036 12:13560630-13560652 AAAGACTGAGAGAGGACAGAGGG - Exonic
1095264892 12:40144310-40144332 AATAAAAAAGAGAGGACAGGTGG + Intergenic
1097579822 12:61441417-61441439 AATGCCAAAGAGAGTAAAGCTGG + Intergenic
1098719208 12:73873894-73873916 AATTTCCAAGAGAGTACTGGAGG - Intergenic
1100555401 12:95688215-95688237 AATGACTAAGACAGTAGGTGTGG + Intronic
1101025638 12:100602646-100602668 AATAACTAAAAGAGTACAATTGG - Intronic
1101480808 12:105095186-105095208 AATAACTAAGAGAGTATAGTTGG - Intergenic
1101974627 12:109346240-109346262 AATGATTTAAAGTGTACAGGAGG + Intergenic
1103370063 12:120412501-120412523 AATGACTTAGAGTATACAGGAGG + Intergenic
1105614184 13:21997559-21997581 AATAACTGAGGGAGTACAAGTGG - Intergenic
1105936869 13:25108566-25108588 AATAACTAAAAGAGTACAATGGG - Intergenic
1108252383 13:48580099-48580121 AATAACTAAAAGAGTATAGTTGG + Intergenic
1108943241 13:55984987-55985009 AATGTCTAAGAGAATCCAGCAGG - Intergenic
1109941920 13:69379515-69379537 AATAACTGAGGGAGTACAGTTGG - Intergenic
1110472090 13:75871750-75871772 AATAACTAAGAGAGTAGAATTGG - Intronic
1111965181 13:94854205-94854227 AATGACTGAGAGGGGACATGAGG + Intergenic
1112151681 13:96771530-96771552 AATGGCTGAGGGGGTACAGGAGG + Intronic
1112185658 13:97125628-97125650 AATGACTAACAGAAGACAGGGGG - Intergenic
1112228736 13:97566827-97566849 AATAACTAAAAGAGTACAGTTGG + Intergenic
1112682346 13:101781113-101781135 AAAGACAAAGAGAGAGCAGGGGG - Intronic
1112720645 13:102240687-102240709 AATGACTAAAAGAGTATAATTGG + Intronic
1113381915 13:109812307-109812329 AATGACTGAGGGTGTACAGTTGG + Intergenic
1115065095 14:29250149-29250171 AAAGACTAAGATAGTAAAAGTGG - Intergenic
1115924907 14:38421601-38421623 AATAACTAAAAGAGTACAATTGG - Intergenic
1116193356 14:41688297-41688319 AACAACTAAGAGAGTATAGTTGG + Intronic
1116711616 14:48374952-48374974 AAAGACTAATAGAATAAAGGGGG + Intergenic
1116766400 14:49075804-49075826 AATGACTAGAAGAGTACAATTGG + Intergenic
1117946145 14:61023959-61023981 AAGGACTAAGAGGGGAGAGGGGG + Intronic
1118929499 14:70227776-70227798 AAGGACAAAGAGAGTGAAGGGGG + Intergenic
1120822267 14:88922921-88922943 AATAACTAAGAGAGTATAACTGG - Intergenic
1122044581 14:99014314-99014336 ACTGACCAAGAGGGGACAGGAGG - Intergenic
1125037511 15:35143148-35143170 AATCCCTCAAAGAGTACAGGAGG + Intergenic
1127033082 15:54885594-54885616 AATAACTAAAAGAGTATAAGTGG - Intergenic
1127176874 15:56367894-56367916 AATGAATAAGAGAGTTCAGCAGG - Intronic
1128567025 15:68707820-68707842 AGTGACTGAGAGGGTGCAGGGGG - Intronic
1128623117 15:69168992-69169014 AATGACTAAGAGAGTACAGGAGG - Intronic
1128840111 15:70843234-70843256 AATGGCAAAGAGAGAACAGATGG - Intronic
1131288796 15:91086821-91086843 AATGTCTGAGAGAGAAAAGGGGG - Intergenic
1133457756 16:5957820-5957842 AATAACTAAAAGAGTATAAGTGG - Intergenic
1133490015 16:6258744-6258766 AATAACTAAGAGAGTTTAGTTGG + Intronic
1134589015 16:15436549-15436571 AATAACTAAAAGAGGGCAGGTGG - Intronic
1135354902 16:21760893-21760915 AATAACTAAAAGAGTACAATTGG - Intergenic
1135939751 16:26810806-26810828 GATGACTAAGTGAGGACAAGGGG - Intergenic
1137861357 16:51849904-51849926 AATGACTAACACATTGCAGGTGG - Intergenic
1138190707 16:55011426-55011448 AATAACTAAAAGAGTAGAGTTGG - Intergenic
1138236499 16:55387784-55387806 AATGACTAAAACAGTGCATGTGG + Intergenic
1140343083 16:74184612-74184634 AATAACTAAAAGAGTACAATTGG + Intergenic
1140959103 16:79895591-79895613 AATGAATCAGAGACTTCAGGGGG - Intergenic
1146195531 17:30809244-30809266 ATTTACAATGAGAGTACAGGAGG - Intronic
1147884968 17:43678163-43678185 AATGACAAAGTGAATCCAGGTGG - Intergenic
1148145749 17:45363745-45363767 AAAGGCCAAGAGAGAACAGGAGG - Intergenic
1148284354 17:46374290-46374312 AATGAATAACAAAGTAGAGGAGG - Intergenic
1148306575 17:46592211-46592233 AATGAATAACAAAGTAGAGGAGG - Intronic
1149738687 17:59021752-59021774 AATAACTAAAAGAGTACAATTGG + Intronic
1153444818 18:5159105-5159127 AATCAGAAAGAGAGAACAGGTGG + Intronic
1155731287 18:29161844-29161866 AATAAATAAGAAAGTACAGAAGG + Intergenic
1157014013 18:43687618-43687640 AATGAATAAGAGAGTAAATAAGG + Intergenic
1157071295 18:44411927-44411949 AATGATAATGACAGTACAGGAGG + Intergenic
1157791738 18:50538072-50538094 ATTGACTGGGAGAGGACAGGAGG - Intergenic
1158181722 18:54723485-54723507 AAGGAATAAGTGAGTTCAGGAGG + Intronic
1159056386 18:63468937-63468959 AATGACTAAAAGAGTATAATTGG + Intergenic
1159484512 18:69037554-69037576 AATGACTCAGTGAGTCTAGGTGG - Intronic
1159848049 18:73489898-73489920 AATAACTAAAAGAGTACAACTGG - Intergenic
1161639845 19:5415037-5415059 AATGACAAAAAGAGGCCAGGCGG - Intergenic
1164466583 19:28492091-28492113 AATAACTAAGAGAGCACAACGGG + Intergenic
1164855953 19:31521674-31521696 AATAACTAAAAGAGTATAAGTGG - Intergenic
1166108235 19:40608039-40608061 AATGTCTTAGAGGCTACAGGTGG - Intronic
1166312783 19:41972468-41972490 AATCATTAAGAAAGAACAGGCGG + Intronic
927020385 2:19010650-19010672 AATGCCTAAGAGATTGCAGTTGG + Intergenic
928127824 2:28628451-28628473 AATGACTGAGTGGGTACAGAGGG - Intronic
929324319 2:40589054-40589076 AATAACTAAAAGAGTACAATTGG + Intronic
930679325 2:54239637-54239659 AATGACTAAGAAACTCCAGGGGG + Intronic
930961002 2:57261462-57261484 AATAACTAGGAGAATACATGTGG - Intergenic
931530003 2:63203316-63203338 AATGACTAAAAGAGTATAATTGG - Intronic
931648284 2:64445318-64445340 AATAACTAAAAGAGAAAAGGAGG + Intergenic
932929052 2:76012030-76012052 AATGACTTAAAGTATACAGGAGG - Intergenic
937075711 2:119104840-119104862 AAGGAGGAAGAGAGTAAAGGGGG - Intergenic
939752133 2:146061266-146061288 AATAACTAAGAGAGTACAAATGG + Intergenic
941114735 2:161459447-161459469 AATAACTCAAAAAGTACAGGAGG - Intronic
942882710 2:180882572-180882594 ATTGTCTAAGAGAGTACACTGGG + Intergenic
944970189 2:204984060-204984082 AAATACTAAGAGAATAGAGGTGG + Intronic
948932518 2:241141331-241141353 AATGACTGACAGAGGACAGAAGG - Intronic
1169069309 20:2712990-2713012 TGTGTCTAAGAGAGAACAGGAGG + Intronic
1169710582 20:8557682-8557704 AATGACTAAAACAGTAAAGTTGG + Intronic
1169753043 20:9014963-9014985 AAAGACTTGGAGAGAACAGGAGG - Intergenic
1175615797 20:60397329-60397351 AAGGTATAAGAGAGAACAGGAGG + Intergenic
1176664175 21:9669132-9669154 AATCCCTAAGGGAGTACATGCGG - Intergenic
950927154 3:16752937-16752959 AATAACTAAAAGAGTACAATTGG - Intergenic
951001205 3:17561803-17561825 CATGACAAAGAGAGCACAAGAGG + Intronic
951453965 3:22870131-22870153 AATGACAAAGACAGTAGAAGAGG - Intergenic
951517265 3:23574362-23574384 AATAACTAAAAGAGTACAACTGG + Intronic
951889360 3:27553992-27554014 ATTGGCTAAGAGAGTTCAAGAGG - Intergenic
953012183 3:39037463-39037485 AATAACTAAGGGAGTACAATTGG + Intergenic
953353913 3:42238120-42238142 AATAACTAAAAGAGTAAAAGTGG + Intergenic
953380313 3:42466087-42466109 AATAACTAAAAGAGTATAAGTGG + Intergenic
955277902 3:57565464-57565486 AATAACTGAGAGAGTACAATTGG - Exonic
956986711 3:74709650-74709672 AATGACTAAGTCAGTACAAGTGG + Intergenic
957332998 3:78790471-78790493 AATAACTAAGAGAGTATAACTGG - Intronic
957397982 3:79668865-79668887 AATGGCAAAGAGAGTATAGACGG + Intronic
957419329 3:79948882-79948904 ACTGAGCAAGAGAGTAGAGGTGG + Intergenic
957425888 3:80038179-80038201 CATGATTAATAGAGTACAAGAGG - Intergenic
958115080 3:89204826-89204848 AATGGCTATGAGTGTACAAGGGG + Intronic
959114154 3:102156139-102156161 AATAACTGAAAGAGTACAGTTGG + Intronic
960330664 3:116356569-116356591 AATAACTGAGAGAGTACAATTGG + Intronic
961771478 3:129253250-129253272 AATAAACAAGAGAGTACAAGCGG + Intronic
962848367 3:139289894-139289916 CATGACTAAGAAAAGACAGGGGG - Intronic
963701906 3:148637228-148637250 AATAACTAAGGGAGTACAACTGG + Intergenic
963969947 3:151419036-151419058 AATCACTAAAAGAGTAGAAGTGG - Intronic
964521101 3:157568419-157568441 AATAACTAAAAGAGTATAAGTGG - Intronic
964913161 3:161806921-161806943 ATTGGTTAAGAGAGAACAGGGGG - Intergenic
965039768 3:163491205-163491227 AATAATTAAAAGAGTACAGTTGG - Intergenic
967481838 3:189981461-189981483 AATGAATATGAGAGTACGGTAGG + Intronic
968026665 3:195448247-195448269 AATGACTATCAGATTACAGTAGG - Intergenic
978655213 4:111057957-111057979 AATAACTAAAAGAGTACAATTGG + Intergenic
978733039 4:112052906-112052928 AATGAATAATAGATTACTGGTGG - Intergenic
979129268 4:117020099-117020121 AATAACTAAAAGAGTATAAGTGG + Intergenic
979402238 4:120262590-120262612 AATAACTAAAAGAGTACACTAGG + Intergenic
979912746 4:126390202-126390224 AATAACTAAAAGAGTACAATTGG - Intergenic
980502622 4:133675803-133675825 AATGACTATGAGAGTATTGGGGG + Intergenic
981080912 4:140638151-140638173 AATTGCAAAGATAGTACAGGAGG - Intronic
983630725 4:169846555-169846577 AATGGCTAAGAGATTACAGAGGG + Intergenic
984119928 4:175729579-175729601 AATAACTAAAAGAGTATAAGTGG + Intronic
984289780 4:177781123-177781145 AATAACTAAAAGAGTATAAGTGG + Intronic
985409637 4:189669811-189669833 AATCCCTAAGGGAGTACATGCGG - Intergenic
988187233 5:27882014-27882036 AATAACTATAAGAGTACAGTTGG + Intergenic
989107195 5:37874575-37874597 AATGACTAATAGAAAACAGGAGG - Intergenic
989252879 5:39335575-39335597 GATGATTTAAAGAGTACAGGAGG + Intronic
989658862 5:43776568-43776590 AATAACTAAGACAGTATAAGCGG - Intergenic
991146962 5:63318387-63318409 ACTGACTATTAGAGTACAGAAGG + Intergenic
991360056 5:65810606-65810628 AATAACTAAAAGAGTGCAAGTGG - Intronic
991598902 5:68333144-68333166 AATGAAAAAGAGGGGACAGGGGG + Intergenic
996330282 5:122320959-122320981 AATGAGAAAGAGACAACAGGGGG - Intronic
999918976 5:156297157-156297179 AATAACTAAGAGAGTATCAGTGG - Intronic
1001901882 5:175438107-175438129 AATGACTTTCAGAGTACAGGTGG - Intergenic
1002010025 5:176271708-176271730 AATGACTGAGGGAGTACAATTGG + Intronic
1003702158 6:8479191-8479213 AATAACTAAAAGAGTACAATTGG - Intergenic
1004165584 6:13253855-13253877 AAGGGCTAAGACAGTAAAGGAGG + Intronic
1005000394 6:21234159-21234181 AATGGCTAGGAGGGTACATGGGG - Intergenic
1005027828 6:21480723-21480745 AATAACTGAAAGAGTACAGTTGG + Intergenic
1005401859 6:25442831-25442853 AATCAATCAGAGAGTAAAGGAGG - Intronic
1005482356 6:26266702-26266724 AATGACTGCCAGAGGACAGGAGG - Intergenic
1008549479 6:52614060-52614082 AATTAATAAGAGATTGCAGGAGG - Intergenic
1009943048 6:70311661-70311683 AATAACTAAAAGAGTACAACTGG + Intergenic
1010329521 6:74606883-74606905 GATGACTCAGGGAGAACAGGGGG - Intergenic
1011033719 6:82951088-82951110 AATAACTAAAAGAGTATAAGTGG + Intronic
1011061286 6:83272011-83272033 AATAACTAAGAGAGTATAATTGG - Intronic
1011180525 6:84614549-84614571 AATGACTGAGACATTACAAGAGG + Intergenic
1011673797 6:89711249-89711271 AACTACAAAGAAAGTACAGGTGG + Intronic
1012027206 6:94010802-94010824 AATGACTAAAATATTACAGTTGG + Intergenic
1012468898 6:99547864-99547886 GATGACTATGAGATTACAGAAGG + Intronic
1014553348 6:122814563-122814585 AATAACTAAAAGAGTAGAAGTGG - Intergenic
1014769300 6:125443281-125443303 TATGGCTAAAAGAGTACAAGGGG + Intergenic
1015194044 6:130505764-130505786 AATAACTAAAAGAGTACAATTGG + Intergenic
1015384953 6:132611417-132611439 AATGACTAAAAGAGTAGAATTGG + Intergenic
1015703473 6:136061773-136061795 AAAGACTAAGATAGTGCAAGTGG + Intronic
1016381202 6:143482777-143482799 AATGACTAATAAAATTCAGGAGG + Intronic
1016422810 6:143902398-143902420 AATGGCTGAGAGACTATAGGAGG - Intronic
1019269078 7:135986-136008 GATGACTCAGTGAGCACAGGGGG + Intergenic
1020950728 7:14673421-14673443 AATGACTTTGAGAAAACAGGAGG - Intronic
1021169659 7:17383560-17383582 GATGACTTAAAGAATACAGGAGG + Intergenic
1024961758 7:54983986-54984008 AATGACTAAAAGAGTATAATTGG - Intergenic
1025061866 7:55816334-55816356 AATAACTAAAAGAGTATAGTTGG + Intronic
1025603270 7:63019253-63019275 AATAACTAAAAGAGTATAAGTGG - Intergenic
1027981719 7:85232704-85232726 ACTAGCTAAGAGTGTACAGGTGG + Intergenic
1028481093 7:91305646-91305668 AATGATTAAAGGTGTACAGGAGG - Intergenic
1031382334 7:121102494-121102516 TATGCCTAAGAGAGTTTAGGGGG - Intronic
1031509338 7:122629463-122629485 TATTACAAAGAGAATACAGGAGG + Intronic
1032731678 7:134649131-134649153 AATAACTAAAAGAGTACAATTGG - Intronic
1032751362 7:134845089-134845111 AATCGCTAAAAGAGTTCAGGAGG - Intronic
1033166360 7:139041799-139041821 AATGAAAAAGAGAAAACAGGAGG + Intergenic
1035063551 7:156088874-156088896 AATGACAGAGAAAGAACAGGAGG + Intergenic
1037722375 8:21455798-21455820 AATGACTTAAAGTGTACAGGAGG + Intergenic
1039228450 8:35416570-35416592 AATGTGTAAGAAAATACAGGTGG + Intronic
1039647020 8:39297635-39297657 AATGACTAAAAGAGTATAATTGG - Intergenic
1040004973 8:42612400-42612422 AATAACTAAGAGAGTATAATTGG - Intergenic
1040958126 8:53001290-53001312 AATTGCTAAGAGAGTATAGTTGG - Intergenic
1041705794 8:60844951-60844973 AATGATTAAGACAGTACACCAGG - Exonic
1041760225 8:61358266-61358288 AATGACTAACATAGGAAAGGAGG - Intronic
1044970779 8:97617288-97617310 AATGAATAAGTGAGGACAGAAGG - Intergenic
1045275911 8:100705450-100705472 AATGATTATGATAGTACAGTTGG - Intronic
1046113666 8:109758629-109758651 AATAACTAAAAGAGTACAACTGG - Intergenic
1048511565 8:135066916-135066938 AATGACTAAAAGAGTTCAAAGGG - Intergenic
1052422948 9:28267495-28267517 AGTGAATATGAAAGTACAGGAGG - Intronic
1052595489 9:30552439-30552461 AATAGCTTTGAGAGTACAGGGGG + Intergenic
1054816049 9:69476621-69476643 ATTGACTAGGAAAATACAGGTGG - Intronic
1056740385 9:89249524-89249546 AATGACTAAGAGGGAACATCAGG + Intergenic
1057613556 9:96567801-96567823 AATAACTAAAAGAGTACAACCGG + Intronic
1058138687 9:101335576-101335598 AATGAATAAGGGAGTGAAGGAGG + Intergenic
1059253118 9:112905023-112905045 GTTGAAAAAGAGAGTACAGGTGG + Intergenic
1060197735 9:121634334-121634356 CAGAACTAAGAGAGTAAAGGCGG - Intronic
1061776281 9:132967124-132967146 GAAGACAGAGAGAGTACAGGTGG - Intronic
1061827206 9:133266259-133266281 AATAACTAAAAGAGTATAGTTGG + Intronic
1203661925 Un_KI270753v1:52620-52642 AATCCCTAAGGGAGTACATGCGG + Intergenic
1203673119 Un_KI270755v1:35669-35691 AATCCCTAAGGGAGTACATGCGG + Intergenic
1187683075 X:21787644-21787666 TATGCCTAAGAGAGAACACGTGG + Intergenic
1187730662 X:22250689-22250711 AATGAATAAATGAGAACAGGAGG - Exonic
1188472876 X:30559961-30559983 AATGACTTACAGATTGCAGGGGG - Exonic
1188998630 X:36917731-36917753 AATGACTAAAAGTGTATAAGTGG - Intergenic
1189020105 X:37326851-37326873 AATGACTAAAAGAGTATAATTGG + Intergenic
1189088836 X:38055968-38055990 AATAACTAAAAGAGTATAGGTGG - Intronic
1189451284 X:41133502-41133524 AATAACTAAGAGAGTAAAACTGG - Intronic
1189577559 X:42370834-42370856 AATAACTAAAAGAGTATAGTTGG - Intergenic
1190049746 X:47140867-47140889 AAAGACAAAGAGAGGAAAGGGGG + Intergenic
1190404744 X:50075635-50075657 AATGAGAAAGAGGTTACAGGTGG + Intronic
1191766024 X:64699044-64699066 AATAACTAAAAGAGTATAGTTGG - Intergenic
1191990918 X:67036038-67036060 AATAACTAAGAGAGTATAATTGG - Intergenic
1192186438 X:68949983-68950005 AAGGACAAAGAGAGTGCTGGTGG - Intergenic
1193245686 X:79225995-79226017 AATAACTAAGAGAGTATAACTGG - Intergenic
1194499399 X:94660943-94660965 AATTACTAAGAGAGAACATCAGG - Intergenic
1195585105 X:106556119-106556141 AATAACTAAAAGAGTACAATTGG + Intergenic
1195781915 X:108476420-108476442 AATAACTAAGAGAGTATAACTGG - Intronic
1195882909 X:109611316-109611338 AATGTTTAGGAGAGTAGAGGAGG + Intergenic
1196149674 X:112359297-112359319 AATAACTAAAAGAGTACAGTTGG - Intergenic
1196479592 X:116131575-116131597 AATAACTAAAAGAGTACAATTGG - Intergenic
1197254502 X:124248170-124248192 AATGACAAAGAGAAAAAAGGAGG + Intronic
1199442670 X:147886173-147886195 AATAACTAAAAGAGTACAATTGG - Intergenic
1199907354 X:152246809-152246831 AATGAATAAGAAACTACAGGTGG + Intronic
1200335223 X:155343603-155343625 AATAACTAAGAGAGTAGAACTGG - Intergenic
1200351245 X:155497618-155497640 AATAACTAAGAGAGTAGAACTGG + Intronic
1201852436 Y:18500738-18500760 ACTGATAAAGAAAGTACAGGAGG + Intergenic
1201880885 Y:18819646-18819668 ACTGATAAAGAAAGTACAGGAGG - Intronic
1202329093 Y:23726765-23726787 AGTGATAAAGAAAGTACAGGAGG - Intergenic
1202541678 Y:25943289-25943311 AGTGATAAAGAAAGTACAGGAGG + Intergenic